Pongo_pygmaeus Locus Poly:10:SNORD73
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Poly:10:SNORD73
Pongo_pygmaeus
Poly:10:SNORD73
4
SNORD73, SNORD73
1001..1072, 2788..2854
3854
TTCAAGCTGATTACTGAAGATGTTCAGGGTAAAAACTGCCTGACTAACTTCCATGGCAT
GGATCTTACCCGTGACAAAATGTGTTCCATGGTCAAAAAATGGCAGGTGAGACCCAAAGT
TCGTTAGAGTGGTTGTGCTATGGGTGTTTGACCAAGGATAGCATGGTTTGATGACCGGAA
GGAGCAAGTTCGTTTTATTTATTTATTGAGACCAGTGAAATGTCCACAAAGTTCATTTAA
AATTTTTGTTTTCTTGCCGTTGTTGAGTGCTAACTCTGGGGTTGCCACACCATATTTTAC
TTACCATTTAAATCTAAGATTTAATAGTGGTGTATCATCAAAGTCAGATTTTCTTGCTGC
ATAAATTAGTGCTTTTTTTGAGGAATGTTTAGGTGCAGGTGGGCGGTTTTGCCTGTCTTA
AGAATATTTTTTGCCCTCAGAATTGAGTGAATGTTGATTAACTGTGGCAATAGAGCATAA
TTGTGGCAGAGCCTCTGGAGTGAGGTTAAAATCTGGGCTCCATTTCCCTATTGTGTTCTC
TTTGGAAAGTAACTTGCTTTCTAAGCCTCGGTTTCTTTATTTGTAAAGTGCAAGTAAGAG
TGTCATTTTATTGAATTGTGAGGATGAAATGAAAATATTTCAGACATGTCTGGCTAACTA
TTCAGTTGCAATATTTTGTGGGAGTTTTTTGTTTTTGGGAGATTGAGTCTCTTATCGTCC
AGGCTGGAGTGCAGTGGCACCATCTCTGCTCACTGCAATCTCCTCCTCCTGGGTTCAAGC
GATTCTCGTACCTCAGCCTCCCGAGTAGCTGGGATTACAGGCACCCGCCACCACGTCCAG
CTAATTTTTGTATTTTTAGTAGAGACAAGGTTTCACCATATTGGCCAGGCTGGTCCCGAA
CTCCTGACTTCAAGTGATCTGCCTGCCTCAGCCTCTCAAAGTGCTGGGATTACAGGCGTG
AGCCACTGCACCTGGCATAGTTCGAATATTTTGTATGTGGGAATGAATGATGACAAAATG
TTTTGGTCCCAAATGATACATACTGATTATACCATTACATTTATCCTGACATTCCTCTAA
GGCTTTATGGTTTACATTTCTAGAAATATTTTAAGGTCCCTTAGCTGTAAATTGTATTTG
ATTAGTTTTTTTTTTATACTAAGGTATAAAATTTACAAAATGCAAACAAGGTAAATCCGG
TTTCATCACTACCCAAGATGGTTTTTGTTTTTTCAATTTAGGCAATAATATGACCACTAA
CTAGGGGTTTTTAATTAGCTCTGAAATTGGGTATTTAATCATCACATGGCTTTAGTTTGG
AACATAAAAGACATCTTTCAAAGTGTGCATTTAGAGGAGTTATAGCAGTCACCTATTTAC
AACAGTTTTTTGAAAAATGACATAATCACTGTAGATGTTCATACCATAGAATACCATGGA
TCCTCTCAACCTATTTTCCTCTGGCGTAGTTTTACACTTGAGGGGGTATGAGCTGTTTAA
AGGGGTATATGTATGTGCAATGGATGTGGGGTTGGGTGCCGTCGAGATAGTGGTGGTGAT
ATAATGGAGGGTAGAAAGGAGGAGGGAGGGCAGTTGAGAGGACCTGGTTATTTAATTGGG
TAAGAATTTGGGGGTAACTATTGGTAAGTTCAACGAAGTTAATTCTGTAAACTTAAGAGA
TGTTACCTATATTAGGATACTTTAATAATGAGTGTTTGACAATCCAGCTTTTTAAAATTA
GAACTTGAGGGATAAATGGATAACGTAAAACCTGTTAAATCTGACGGTATCTTTTTTCTC
CAGACAATGATTGAAGCTCATGTTGATGTCAAGACTACCGATGGTTATTTGCTTCGTCTG
TTCTGTGTTGGTTTTACTAAAAAACGCAACAATCAGATACGGAAGACCTCTTATGCTCAG
CACCAACAGGTCCGCCAAATCCGGAAGAAGATGATGGAAATCATGACCCGAGAGGTGCAG
ACCAATGACTTGAAAGAAGTGGTCAATAAATTGTAAGTGTTTCTTTGCTTCCTCACACAA
CACAACCTTGAGTATTGGATTATTCCTCAGATGAGGGAAAGCATATGAGACTAGGTAAAG
GTCTGTTGAAATCTTGTCTGTGAATCCTTCTAGCTATATCTCTTCAAGTGAAAGAGTGTT
AAGTACTCAGTAAATATGATGATGATGATGATGATGATTATTATTATTATTATTATTTGA
GTCAGAATCTTGCTCTGTTGCCCAGGCTGGAGTGGTGTTGCGATCCTCCTTGGCTCACTG
CAACCACTGCTTCCTGGGATCAAGCAGTTCTTGAGCCTCAGCCTCCTGAGCAGCTGGGAA
TACAGGGGACTGCCACCGTACCCAGCTAATTTTTTTTGATTTTTAGTAGAGATGGGGTTT
CACCATGTTGGCCAGGCTGGTCTTGAACTCCTGACTTCAGGTGATCTGCTAGTACTCTGT
AAATGATAACAGTTTTTTCGTGTTTATTTATTTTGAATGAAGCTGTCTCACAGTAGATGG
AGTTGAAGGACAGGAAATGTTTTTCCCCTACTTGGAAAATACACTGAATAAGTTGAGTGG
AGTGGGACGTTCCTGGAGTCCCAGCTACTCAGGAGGCTGAGGTGGTAGGATTGTTTGAGC
CCAGGAGTTTGAGGCCAGCCTGGGCAATATAGGGAGACCCTGTCCCAGAAAATAAAAAAC
ATACATATATATATATATATATATACACACACACACAAAGAGAAATACACTGAATAGACA
AAACCTTTCATGATTAATAATGCATGGGAATAAGTGATGAAAAAAGTTTCGGTCCCAGAT
GATGGCCCAGTGATAACTTACATTTTTCTGATGTTCCCATGCAATATACAATTAATTAGC
TAAGAGGGTTAATGGAAAAAGCCTAAGGCTTGGACTCAGAATACTAAGTTTGCCACTAGC
TAGCTATGTAATTCAGATCATCCTTTACATGTGAAAGGAAAATAATAGGTTATCTTACAG
GAGGATTTATGCAGGTTAAATGAGGTAGGTCTTATGTGTAGGTTTATTCCAAGGCTTCTC
TACTTTTAAAGGAAATGGCGTATCTTATATCTGAGAATTAGGACTTTAAGAAAAAAAATT
TACTGTTACTGGTTTGCAGGATTCCAGACAGCATTGGAAAAGACATAGAAAAGGCTTGCC
AATCTATTTATCCTCTCCATGATGTCTTCGTTAGAAAAGTAAAAATGCTGAAGAAGCCCA
AGTTTGAATGTAAGTGAGAAATCATGTGATTCCTGTAGGGCCAAATACATTGTTTTTGGG
TGGAGGAGGAGTGTGGGGCCATATTATGGCCTTCTTTTTCTTCCTGTCATGCTTGCATAG
TAGTGATGACCATTATTTCAAGATACACTAACAGGTTTTTTTTTTTTTTTTGCCTTTTAG
TGGGAAAGCTCATGGAGCTTCATGGTGAAGGCAGTAGTTCTGGAAAAGCCACTGGGGATG
AGACAGGTGCTAAAGTTGAACGAGCTGATGGATATGAACCACCAGTCCAAGAATCTGTTT
AAAGTTCAGACTTCAAATAGTGGCAAATAAAAAGTGCTATTTGTGATGGTTTGCTTCTGA
ACATTCTTTTTAAAAAAATAATCTGACAGCTTGGTGGATTAGTAAATTTGACAGCTGGTA
AACTTTTCTGACCCAGACAAATTGGATATAAACATACTACTATGCAACTTTACTGTGAAG
CTGAAATGGGGCAGAGAAGCTGTTACCAAGTGGGCATTTAGTGCTATCCACCTACAGTCA
CTCATTCAGTTTCTGCCTCTTCTCAAGCCTTCAGTTTTCTCATTTGTTGCTTAGCTGATA
ACCTTGCTTCCTATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved