Pongo_pygmaeus Locus Mono:97:SNORA40
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:97:SNORA40
Pongo_pygmaeus
Mono:97:SNORA40
10
SNORA40
1001..1128
2128
GATAAATGCCTGGTTTTTCAGTGAGGTCTCTGTGTGCTGCTTGGTATTCCTCCAAGAAC
TTGGAGAAAGCTATGTACATTTCCATGGCTGCTTCTCAGCACCACTTCTTCCTGTACTTT
TCCCTTTCCTGTACATGCAGACTGCCTGACAGCCTTGAACTCTGATTTCTGACTACCCAT
TTCAGTGAGATCACTCTTCTCTGCTTGGACAGCACATCTCCGAATTATTTCTAGAAAGTG
CCTCCAGGCAAAAGGCTGGAGCCATCAGGAAGCTCACTTTATGTGTTTTCATTCTTTCAA
GTATCACAGCCGTATAGTGCCTGTGTTTCATTTTTATAGTTGCTTATGGTGGAAAGGTCA
TTCTGGTTATAACAGTTACTCTGTAAGAGAAATGCAAGTTGCTCTTGACAATATTTTACT
TAGCATCATAGTTATTTTTGTATATGCCTTATCTTTCTTATGAGACCAGAAGCACCCTGA
GGGCAGAGTCCATGCATTCTGTATCTTTTTCTCCAGAGCATTCTACACAGCCTATATGCT
ATTTATTATTTAATTTGATTAAATATTTAATGAAAAATCTTTAGAATAAATAAATAAAAT
GAATGAAATAAAACACTTTATGAACTTTTGTAATAATTTCAAAGGCCACAAAATCCATTA
CACAGACTAGTTTTCTTCAACTCATCAGTTATTTTGTTTTCTGCAGCAATCACAAGAATA
TCTAAGTTCCTCATACTACATTCTTCCCCTGCTGATTCACAAATTTATTATAATCAGAAA
GCATGTGAAAAACTGAGAAATGGGAGAAAACAACCACTGACTGCCATTTGGTAATAGGAG
TAATTATTAGGAGTCAATTCGAGCATTGCTTTTAATCTTTTGAGTTGCTTTGTTGGTTGT
CATTCTCTGTAACTACTAAAAAGTCCAGCTAGAATTTGTTTTCTTGGTCACACAGGCAAA
GATGATGTTTGGAGTTCAGTGGTCAAGAAAACCCTGATGACTGCACTTATGTATGTTTTT
GTTTAACTTGTGGACAAAGACTTATGGATAGGTGCAAAAAATAAGTCCTCTTTTGCAACC
TGGAACACATTGTTCAGTATGAGTTTTGATACATATAAGAAGGGATATTATGATACCTGA
GACAGTTAACTGATGGGAGTATTGATAACCATAGAGGTTGGTTCCAGGCCAGGCTCAGTG
GCTCATGCTTGCCATCCCCATACTTTGGGAGACTGAGATTAGAGGACTGCTTGAAGCCAG
GAGTTTAAGACCAGCTTGGGCAAGAAAGTAACACCTTATCTCTACAAAAAATTAAAAATT
AGCTGGGTTTAGGGGCATGTGCCTGTACTTGCAGCTACTCAGGAAGGGGAGGCTGAGGCA
GGAAGATTGACCCCAGGAGTTGCAGGCTGCACTGAGCTTTGATGGCACCACTGTACTCCA
GCCTGGGCAGCAAAGACAGACCCTGACTCTTAATTTTAAAAAGGTTGATTTTAGGACTGT
AGAATAGATAGTTAAAAAGCATGGGATATGAGGGAAATCCTCAGCTGTATTAAATTTGTA
TTCCAATTTCATGTTGACTTGATACAGAAGATGGCATTTGGTTTTTAAAGCTTTTATCTT
GAGAACATGATGTCTGGAGTTAAAGGTATTGACATATTCCACACATCTGTACTATTCTTG
AGTATGATCACTTAGGGCATCAAATTGAGAACCAGGCAGATCCACCTATACTAAAAATGA
CCCTAAAGTAAGTTGGTTAAAGAAATTAGACCCCAAAGATTCTTGATTTTTCCGTAGGTG
AATTTTGAAGTCTTCATCAGTATATCCATGTAAAAAGGAGATGACAGAAACCAAAATAAA
ATAATTATGGGCTGACAGGACAACTGGATTAAAATAAGCATCAGTTTCATTAAAAAGGGC
TAACTTGAAGATAAATCTTTTGAAGATAAATTTTGACACCAGTTCTTTAGAGGCTCTAAA
GTGACCTTGATGGAGAGTGAAAGAAATCACAACATGGAATTCGTCGAATAAAAATTTATT
GACTTTAAATAATTTTGCCTAATGTTACATACACACGATTAAAAAAAACACCTCTTTACG
CTGTCAAAAAAGAAAGAAAGAAAGAAAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved