Pongo_pygmaeus Locus Mono:110:SNORA62
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:110:SNORA62
Pongo_pygmaeus
Mono:110:SNORA62
4
SNORA62
1001..1151
2151
ATAAAATAAGCAAATGTAAAATGTTAATATTTGAGAAAATTTGGGTGAAGGTATCCAGA
AATCTGTATGATTCTTGTAACCATTCTCTGAGTGTCAAATTATTTTTAAAAAGCCTTTAT
CCCACAATTTTTAAAAACACAAACTGAATCAACAATTAAGAAAATGTTGCAAGTAGTTTT
CAAAAATAAATTCTAGTGGACATTTATTCGTTATTCCTCTATTCATTAAACACTTCTCAC
CTACTTATTTATAAGCTTTTCCCCTGAGAACTTTCATTTTACTGTGAAACATTATTAAAG
CGAAATGATGAGAGTGTAAGCATTTTTAAATTGATAGCAAGTAAATTCAGACAAAAATGT
TACAATATTTTTTATTTTAAGCAACTGAGGGATTCTTTTTTTTAAAGTTTTTGATTGAAT
TAGAAAATTTTAGTCACAGTATTAAGAAACATGATTCTTTTCTACGCTACCAACAAAAAA
CACTATAAAATATTTTAAAAATACTTTTTTTTTTTAAAAGACATACTCCACTCTCACTCC
CATCACCTCAAAAGGGAAAGAAACCTTGGCCCTGTTAAATAAGTTAAAAAGTTGATTTTC
AGTTTCAGAGCTTTTTTCGTTTTCAAGGGGAAAGAAATGATTTTAAATTCATCCACTAGA
GGGCGTATAATAATTTTACTATCACTCTAGTCAAGAAACCCCAACAAGTGCATTCAGCTA
ATTTTATCTTAAGATTCAGACTTTTTTCCCACATTACAAAGTGAGCCTTTTAGTTTTCTG
TAATTCTTTGCAACCTGACCTTATTTAAAGTTCAGCTTTGAATTAGATCCAACAGAGGCT
GTGAGTTAAAGTCTTTGGAAGGGTTACTTCACGTAGAACCCGAGAATCTTATATTTCTTT
AAGGTTTTAGCTACTTCTCTCTGCACCATCCCAGTTGGACTTGGAACCATATGACCTGAG
TTTTACTTTCTGCTCTGCCTGGGCCACAATTTCATCTTAATATTTCATGTTTTAAAGGCA
TAATGATGTCACTGACTGGCTGATGAAATCACAAGCGTAGGTAGTATGCTACATGAGGGG
CAAGTTTTTTGCTAACACCACAAAGGTCTCTGGCTCAATGAGTGGAGTTTGATAGTAGTT
CTTGTGACAAATGTAATGTTATTGCGTGCCCGTTTTGAGGAGAGGTGAAAACATTTGAAA
AGTAGTGTGTTTTTTTCTGCATTTGTCCGTATTTCTTGCTCAGGCCTCTCAGGCATTACT
TGGCCTTTCCATTTTCACACCAACTTGGTGAGTTCTACCATAAGATTCTAAAAAGATGGG
TTGTTGTGTGGTTCAAATTGGTTCATTTATAACTGGAAAAAATTTATAATTAAAAAAATA
AAATATGTTTAAAGAAAGCCATAATGATGAAACTTTCAATTAGCAATGACTTTGAAACAT
AGTACTATGATTGAGTTAATGGCTATCTTATTTAACACATGCTTATTTTTTAAGCAACTC
TTTGGTAAAACAAGCTATAGCTGGCATTCTCTGTCATAAAAGATAAAGCAGTTATATCCT
TCAATCAGGGAATTTAATATTTGGTAGTGGAGATTTAAAATGTATGTGACCCAGGTAATA
CAAGATAGACCAATAAATTTTAAGAAAGGTATAATAAAGTGTACACAAATTCAGAATCTT
ACTTGCCCATAAATTAACTTGCTGTTGTCTTAGTTCTGTTTATTTTGTGCTCCAAGGCCA
TGTTCATTTGAATGATTAATATAGAGATCCACTTTGCTTTTAGTTGTTCATTTGTCCTTG
GATTATATTTCTTTAATTTCGTTATATTTCTCCTCTCTTGTCCCTGGCCCTGGTTCTTAT
CAGTGTTTGCTTTATTTTGCCATAAACAAGAACATTCTCTTTTCATTTTTCACAGTCAAT
TGCAGTTGTTCATTTCTTCTTAGAATATTAACACTCACCTTACCCACACTAATTATACTC
TTACCTAGTGTTGTCCAAAGGTAATTATCTTCGGATGTGTGCTTCAGTTTCCTCATCTAC
ATACATGGAGAAAATAGTAATAGCTACCTCTAAGCCTATCATGACAATAAATGAGTTAAT
ACATGCAAAGCACCTGGAATAGTGCCTGGAACACAGAAACTGTATAAATCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved