Pongo_pygmaeus Locus Mono:286:SNORA63
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:286:SNORA63
Pongo_pygmaeus
Mono:286:SNORA63
5
SNORA63
1001..1132
2132
GGAAAAAATATTGTAATAATCCTGTCAAATAAAAAATAAATACAAGAATAATTAGAAGA
AATAGTCCCTACCCAAATGAAAAACAACCAGAAAAATAATCCTGGCAATATGAAATAACA
GGGTTCTATAGCACCCCCAAAAGATCACATTAACTTTCCAGAGGAAGGTTAAGCAGAAGA
AAAGAAATAAGAAAGATCAGAGCAGAACTAAATGAAATTGAAACCAAAAAATGAGAAAGA
TTAATGAAACAAAAGGCTGGTTGTTTGAAAAGATAAACAAAATTGATAGACCACTACATG
GATTCACCAAGAAAAGATGAGAGAAGATTCAAATAAGCTTAATTACAAATGAAAATGGAA
ACAATACAACTGACACTACAGAAAGAATAAAGATCATTCGAGACTAGTATGAACACCTCT
ATGAACACAAACGAGAAAATCTAGAGGAAATGGATAAATTCCTGAAAATATACAACCCCC
CTAGCTTGAATCAGAGAGAAATATAAATCCTGAACAGAGCAATGACAAGCAGTGAAATTG
AATGAGTAATTTTAATAACCGCCAACAAAGAAAAGCCCAGGGCCAGATGGATTCACAGCC
AAATTTTACCAAACATTCAAAGAACTGGTACCAGTTCTACTGACACTATTCCAAAAGATT
GAGAAGGAGGGAATGCTCCCTAACTCATTCTATGAAGCCAGTATTATCCTGATACCAGAG
CCAGGAAAGCACATAAAAAAAGAAAACTGCTGGCCAATATCCATGATAAATATAGATGCA
AAAATTCTCAACAAAATACTAGCAAACTGAATCTAACAGCACATAAAAAAAAAAAAAAAA
AAAATTGACCGTGATCAAGTGAATTTCATCCCAGGGAGGCAGGGATGTTTCAACATATGC
AAGTCAATAAATGTGTTTCATCACATCAAGAGAAATAAAATAAAAATCATATGATCATCT
CAATAGATACAGAAAAAGCATCTGATAAAATCCAGCATCCCACGCAGGATTCAGACTAGA
ATATAGCTGTTAAGTGCTGTGTTGTCATTCCCCCTGCTTAAAATAAAGTTTTTTTCTTAA
CTATACCTGTCTGCTATCTGCTGTAGCAGCCAGGGATGCTTGGTTTCATACATGTTGAAA
GGAATAAATTAAAAAAAAAAAAAACCAGCATTCCTTTATGATAAAAACCCTCAACAAGCT
AAGCATAGAAGGACATATCTCAAAAAAAAAAAAAAAAAAAAGCCATATATGACAACACCA
CAGCCAACAACATGCTGAATGGGGAAAAGCTGAAAGCATTCCCCTTGAGAACTGGAACAA
GTATGCCCATTCAACATAGTACTTACTATAAGTCTTAGCCAGAGGAATCAGACAAAAAAA
AGAAAGAAAGGGCAACCAAACTGGAAAACAGGAAGTCAAACTATCACTGTTTGCTGACGA
TATGATCTCATACCTAGAAAAACCTAAAGACTGCCTCAAAAGACTCCTATATCTGATGAA
TTAATTCAGTAAAGTCTCAGGTTACAAAATCAATGTACACAAATCAGTAACACTGCTATA
CAACAAAAATGATCAAGCTGAGAATCAAATCAAGAACTCAATTTATTTTACTATGACTGA
TAAATAAATGAATAAATAAATAAACAAATAAAATAGCTAGGAATATACTTAACCAAAGAG
GTGAAAGATCTCTACAAGGAGAACTACAAAACAATACCAACAGGAATCATAGCTGTTACA
AACAAACGGAAATACATCCCATGTTCATAGATTGCATGAATCAATGTCGTGAAAATGACC
ATACTGCCCAAAGCAATCTACAGATTCAATGCAATTCCCATCAAAATACCATCATCATTT
TTCACAGAACTAGAAACAACAATCCTAAAATTCATATGGAAACAAAAAACAGCCCACACA
GCTAAAGCAATACTAACCAAAAGGAACAAATCTGGAGACATCACATTATCTGACTTCAAA
TTATAATACAAGACTATAGTAACCAAAATAGCATGGTACTGGTATAAAAGTAAGCACATA
GACCAATGGAACAGAATAGAGAACCCGGAAATAAAGCCAAATGTTTACAATGAACTGATT
TTTGACAAAGCACACAGAAACACAAATGGAGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved