Pongo_pygmaeus Locus Mono:18:SNORD46
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:18:SNORD46
Pongo_pygmaeus
Mono:18:SNORD46
7
SNORD46
1001..1104
2104
AGAAAACTAATTTTCTCACCATCAGTGTATCTTTAAAATCACTGGTCAAGGAATAATAA
TCCTTTTATATTGGTAAAATATGTTTTATTTATTCATACATTTCAGGGTGAAAATATTAT
ACTTCTAATTTCAACCCTTGGGTCCAAATATAGTTCCCCTGAGAATGAGTCATCTATGAC
ATTATAGGTGATGAATGGATGACAGAAATTTGCCCCCTTCCCTCTCCAATCATGGGGCAA
CTGAACTACAGAACTTATCTTCTTGGAAGAAGACATTTTCCCAAGTGGAATACAAGTTAT
GGGGGAATGAGAGGAGTCTTCAGGTTCATGGATGTAACATTTCCCATGCTGTGTTCTTCC
CCACTCGTAAAAGTTTGATATTTAGCATCTGGCATTAAAAAAATCAATCCTGCCTAATGA
CACCCCTCATTCCTAATCTTTCCTTCCTTTCTTTGGTGAAAACCTTTGTGGAGTATCAGT
TCACATTTTCATTAGCATTTCTTCTGAGTTTCCTTAGATTTTACAAGTAGTTAAGCAATT
AGTATACTTCTTAAACCTTTAAGCCAATAAATGCTTAGAATAACACAATGTGTAGTCACC
ACCAAGGTGACAGTGAAGCCAACTATATCATTTTCATCAGCTCATGGGAAGTGCGTACAA
TCAGTGTCTACAATGAGCATGTGAAAACTTAGAGCTTACATTTTACAATATGAAAAGCAC
TTTCCAAACATTTGCTCATTGTACCATAATCTTCTCAAGATTGGCTACACCGAGCAACTC
AAACAGGTCTGTGTCTCAGTCATATTATAGCCTTAGTCCTTACCAATGCCTGGTACCTCA
CAAATGTCTTCTAGACTTTGTTAAGGGAATGGTGACTTTCCCTGAACCATTTAGCAGAGA
TTCAAACTTAGAGGTTACAAAGTAGCTGGTAAGTGTCAGAGTGAGACACAATGCCAAGGT
TGTGGCTACTGGCAGATCATGACCTTGCTTTGAAAAGGGGGTACTAGAGTGATGAAAAAG
TATCTTCAGGTGTGGCTGTGGCCACCTTGGCCACCTGTGTGTCACTTGCTAATGCAGGGA
CTTGTCATAGTTACACTGACTGTTAAAAAGAAACAAAGGAACAAAAAGGGAGGTGGGGTC
AATTCTGGGAGTTCTTTTGGGGTAGGAACAGTAGAAAAAATAGAACCTTTTGAATGCTTT
AAAAAAAAAATTATGTGCCATTGTGGTTTCTCCATGGAGGGGCTCTTTAATTTGTATGTA
TTCATTGTGTAATATAATCCTCCTTGTGGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved