Pongo_pygmaeus Locus Mono:109:SNORA70
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:109:SNORA70
Pongo_pygmaeus
Mono:109:SNORA70
4
SNORA70
1001..1142
2142
ACTCCTGGACTCAAGCGATCCACCTTCTTCAGCCTCCCAAACAGATGGGATTACATGAG
TGAGCCACTGCGCTGGGCCTCAGCTACTTATATTAGAGTTCTACAGAGTATGGCACATGC
TTCCCAGAAGCATTATGAAAGTAAATATGTGGATCGACAATGGCACCCTCCCTTTATCCA
GATGTCACCTGGCTTTGTGTGGTGATTGTACCGTACACGGAGGCACCCGAGGGAAGAGTG
GGAGTTCCAGAAAAGATGGGTTGACGGTGGTTTCCTCACTCTTTTGCTTTCAGCACAGTG
TGATGCATTACAGTTTGTATATGGTCAGCTATATTGTCATAACTGGTTTTTAGATAATAG
TCTCTAATTTTAATTAAATTAACTCTTGTAAAAACAGACAAATGACTTAAAAAGATTTCC
TGCAACATGTTCTCACTCATAGGTGGGAATTGAACAATGAGAACACATGGACACAGGAAG
GGGAACATCACACATCGGGGCCTGTTGTGGGGTGGGGGGAGGGGGGAGGGATAGCATTAG
GAGATATACCTAATGTTAAATGACGAGTTAATGGGTGCAGCACACCAACATGGCACATGT
ATACATATGTAACTAACCTGCGCGTTGTGCACATGTATGCTAAAACTTTAAAGTATTAAA
AAAAAAAAAAAGATTTCCTGCAAAGAAACCATAGATTGAGGTGAAAACAATAACATAAGT
ACAAGCAAATAAACAACAACAACAAAAAGAGCAGACAGTTCTACTCCTAGAAAAAACTCT
TTGCTACCCACATTGAAAGGCAAAAATAATAAGGCTCAAATGAGATTTGATGAAAAGTCT
GACAAAATAGTCAAAATTATCAAGGAGATGGCTTGCAAGTTGTATTTACATCCATTATCA
TTAATGAGGAACCACAACTTAAGGGAATATTTTGCCTTGAAATATTAATGATTGTAGCAT
GATGCTGCCATGATTAGAAAGACATTTAAAAATAGTATTTCTTACAGTCAATTAAGCCGA
TCATGTTACTTTCCTTGTAAGGGCCAGGTGTGCCACGGCTGCGAACAGCAGCCTTCTCGG
TAGTGTGTGCACCCTGTTGCTTGTATGTTGTATGCGTTGCCCTAAGGAGCCTCGGAGACA
GCCCTTTCCAATGGACGTTCATGTCCCTGACCTGATACTGTCTCCCGTCTATGCTCTAGA
TAGGTACACAGGGTGCCTTTGAAAGCCCCAGGGCATGGGAGGAAAGGTCCACATTGGCCA
AGTCATCATGTTCATCTGCACCAAGCTGCAAAACAAGCAGTATGTGGTTAAGACCCCACA
CAGGACCAAGTTCAAGTTCCCTAGCTGCTAGAAGATCCATATTTCAAAGAAGCGAGATTT
TACCAATATTAATGTGGATGAATTTGAAGACATGGTAGCTGTGAAGCAGCTCATCCTAGA
CAGCTATCAGGTCAAACACCCCCAATCATGGCCCCCTGGACAAGTGGCGGGCCCTGTACT
TATGGGGGCTCCCACTGGTTTGCCCCTCCTTATTCACACCCACCAATAAAGCCTTCTTCC
TAACCCCCAAAATAAAGAAATAATAATATTATTTATCTTTATATCATCTTTTAGTGTCTT
TTTTTGTGCATGTATTGTAATGCTTGTAATACATTGGTAAGTATACATAGTGGAAGTATG
GGCTGAACATTTTTTGCTGATTAGAGGGGCACAATCAAAAAGCTGGTAACCACTGATTTG
TACTGAGACTGACATGTCCAGAAGTCCATCCAACTTATAAAGAAGACATGTGGGTGGTGG
CACAGCTTGGACTCTGTAATTCAAGACTGTAAAACATTTCTCACTCTACATTTTATGACC
TATAACACACGATTACATGAACTAGGGAAAGGATTGTGCTTTAGAAAGTCAGGTAAGTGT
ATTTGCATTTCCATTATCAGGAAAAACTCCCTCCATCCTCACCCCTCAACTTCCAGGAAA
AACAGGACTAGATTTAACAATCTTTCAATCAAGTTTGTTTTCTTTGTTACTTTCACCTGG
TTCAGCATCTAAGTAAATCAACATTGCTAATCTGTTAGTTTTTTTTTTTTTTTTTTTTTT
TTTGAGACGAAGTCTCGCTATATCGCCAGGCTGGAGTGCAGTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved