Pongo_pygmaeus Locus Mono:362:SNORD115
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:362:SNORD115
Pongo_pygmaeus
Mono:362:SNORD115
15_random
SNORD115
1001..1081
2081
GGAATAGAGGTGCTTGCACAGTAGGTACTTGTCAAAATCTGTTGATTGTAACTCCAATT
TCTATTTTTTTTCCTTAGTAATGGGGACCTGACATTATTTATGGTGGCCCAACTAAAATA
TTGCATTGACTTGCCTCAGGCTCTTTTAAATTTCAATTCAATAATTTAGAATGACCTTAT
AAGAAAAAGATATTCCTTTTGAAGCCAAGTGGACAATCTGATGTTAATAGTAGTTTGTTG
GTGGGGCTTTTGAAAAGTCTTTAAAATGGTTTGTCTACTCAAGCCCTCTCATACATGATC
ACCATTAACATTTTGATGAGTTAAAATTTCCTTATAGTTATTGCATGTCCTTATAGTTAT
CTCATATTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTCCGGAAG
CTGCCCTTTTATGCGGCTTTAGAAGTTTCATGTTATAAGTGTGAATTGTTCAAGTGACCA
TGGCGATTGTTTCTGATATGGCCACCTCAATTACATAGAGAACGGATGATAAGTGGCATC
ATCCCAGTTCTGCATGACACCACGCCAGTGATTCTCTAAAGTCAAGAGACCTGTATATGT
TGTCCTTCTTGTGTTTGGTGAATCTGTGGTCTATAGACTACATAATGGGCTATTTCTGGG
GTACTGACCATTTTGCTCCATTATGCATGAGCCATATAACTATGGGAAATAATGTTTTCC
TTTTTGACACCTGGCCTAGTCCTCTCTTCTTAGATAAGAGCAAAGGAAGAGCACCATTTG
GCCTGCTGCACCCAGGGCAATTTATAGCATCCAGGTATCCAGCACTGAATATGTAGCAAC
TGCGATCCACCATAGAACATTCGTCTATCTCTGATAAGCATGCTAATATCTACGATACTG
CCTTTGTGGGGAGATGACTCCACAGATTAACCCCCTGGCTTGGGTCAATATTGAGATGTT
ATATTGTCTTCAACAGGGAAGATGACATAAAAATTATGTTCAATAGGATTATGTGGAGAC
TTAACATAAGTGACTAACCTGAGACAAGAAGTTAGAAATACTTGTTTCTTTTAGATGAAT
AATTTTGGAGCTTGAGGAAATGACACCGTTGTGGCGAACTTGCTTTGCCAAACCCTGTGT
ATGCATTTCTGGGTAAACAACACATTTTCATCCTTTAAGCATTGTTTCCATTATTTATAA
TTCCTAATAGTATGAGACGTTTGGGACTCATTCCTCGGTTCTTCTTCTCTCATTGTATCT
TTCATTGGATCTTTCGGTGCTGCAATTTCAGAATTGCAAATTCATCAATGAATTAATGAA
CAGAGTGACTGCCTTCGTCACACATACATTCGAAATAGACCACTGGGCTAGTGGTGATTC
ACTCTTAAGGCTATTATGTTTACTCATTTAAAAAATCTGAATCTCAGTATGAATTTTCTT
CTCAGTGAGTGACTGACCTATCTGATATGATGCTATGACAAAATCTTTACTTTTTACCTG
AATTTGATGGGATTGAAAGTTGAGAACATTTTAATTTATTTTCTGTTTCACTTGATTAAT
AGTGCCCAATCTAACATGCAATGTTCACTTGGGTACATATATACGACTACATCAAATTTT
TTCTTATATTACCTTAAAAATTTTAATATATTGTAATGGTATGGCCAGTTTACTCACTGG
TAAACTTTTCATAACAGAAATATCATGCCAGTGGATACAAATACGTAACATCAGTAATTT
GCTTTGCCTATGAAACAGAGAACTGAATAAGTTGATGGGTAAACTAGTATCTGAATTATA
AACTCCAAATATCAAGTGACTTCATCATTTTCAGTATAATGAAAATACAGGCTGTGAATG
CTTCCAGTTGGTCCTGAAAGGGCCTTTGAGGTGAGTAGGTTCACAAAAGCGGCGACATGT
GTGTCCCAGTGTGCATTCTACTCCTCAGTAAGTGACTGGACATTCTTTATGGCTTCCTCA
TGGTTAAAACAAGTCTTTTTATTGAAATTTTACTGAAATAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved