Pongo_pygmaeus Locus Mono:94:SNORD35
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:94:SNORD35
Pongo_pygmaeus
Mono:94:SNORD35
19
SNORD35
1001..1087
2087
AAGGTTTTTTTTGGAGTTCTCCGGTCTTCAGGGTTGATTTTGTGGAAACGGACTCCTAA
GGGCGAATCCAGGGAGCCTGCCGTCTGGTATTTAATTGTGAATCTTTATGTACTACATAA
GGAGTGAATCCTGGGTGGGCGACCTTGGGTCTTGGAGAATGATCCTCGCTGAAAGGTGTC
CAGGGTGTGAGAGGGGTGATCCTGGTTTAGAGGATGAATTTTGCAATCCCTGAGAGGCCT
TCTGGAATATATAAATTGAAATAACCCCGGGCTTAGATCTGAGTATGAATTACAGGTGAG
GTCAGGGTGGTCGTATCTTAAAGGGTGATTCTGGAGCACCAGGCCTTGGACGCCGGCGCT
TTGCAAGTAAATGTAGAGTATGGGGTTTGGGAGGTTCTGGGAAGGTCTCTAGGGCTGGTT
GGCTGCCGGCTCCAAACTTAGCAGCTCATCAGTTTTCTCCTCATACCTGTAGACTGAGCG
TGCCTACCAAAAGCAGCCGACCATCTTTCAAAACAAGAAGAGGGTCCTGCTGGGAGAAAC
TGGCAAGGAGAAGCTTCCGCGGTACTACAAGAACATCGGTCTGGGCTTCAAGACACCCAA
GGAGGTGCGGGGAACCTCAGAAGAAAGAAGGGGACCCTGGCGTTCCTGCACGTGTGCCCA
CGACGAGTTGCCCTGCCTACATCTGAGTGGCTTCTTCCGGGGCTGATGGGAATTGTAGTT
GCTTCCCTGAGGCCACGCCCCTGGCTCTTTTAAGGAACCGCAGGCCCAAGGCTCACTCCT
TTCTCTTTCCTATCTCTTTAGGCTATTGAAGGCACCTACATTGACAAGAAATGCCCCTTC
ACTGGTAATGTGTCCATTCGAGGGCGGATCCTCTCTGGTAAGTGCGGGAGTTACTGGTGT
CTGGGGCCTGAAATACTGAAAGAAGGGGCTTGGGGCCCAGACTCCTGGGTCCTGGGTGAG
AGGAGTGGTTGGGAATGCAAACTTGTAGGTCCAGGGCCATTGGCAGATGATGTCTGTTTT
CACGATGGTCTTCAGATGCCCACGTGGGCACTGCTGAGAAAGCCACTTGGTAAAACTGAT
GCCGGAAACGGGGCTTTTTGGGATCCCTGCTCAGCTAACTTCTGAGTCCCGGCATGCCCT
GTGTTACCTATGGCCCTCTTTCCTATGGGACCTGACCTATGATCTGCCCCTGCTCCTAGG
CGTGGTGACCAAGATGAAGATGCAGAGGACCATTGTCATCCGCCGAGACTATCTGCACTA
CATCCGCAAATACAATCGCTTCGAGAAGCGCCACAAGAACATGTCTGTACACCTGTCCCC
CTGCTTCAGGTGAGTGCAGTGGCCCATCAAGTTGCTCAGGCCACGCTCTCTCAGCCTTCA
GATTCCAGGTCGGGCCAATTTAAGGCCAACTGAGGGAGGGAATGACTGAGGTGGCATCTT
TGGGAAGCCCCAGAATCTCAGGATTTGTATATCATATGTTTTTCAGAATCAAACTGTTCT
ACAGGTTGAATATCTCTACCTGAAATTCTTGGAACCAGATTTTGGAATGTTCTCGTATAC
ATAGTGAGATGTTTTGGGGATGTGACGTAGGTCTAAACAAGAAGCTCATTTGTTTCATAT
ACACCTTATTCACATAGCCTGAAAGTAATCTTACGCAGTACGTTTTATAATTCTGTGTGT
GAAACAAAGTGCGTACATTGAATCATCAGAAAGCAAAGGTGTCATGCTGGTATTCAAAAA
GTTTCAGATTTTAGCCAGGCACCGTGGCTCAAGCCAGTAATCCCAGCACTGTAGGAGGCT
GAGGCAGGAGGATCCCTTGAGCCCAGGAGTTTGAGACCAGCCTGGGCAACATGGCAAAAC
CCTCTCTCTACAAAAAATACAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved