Pongo_pygmaeus Locus Mono:257:SNORA57
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:257:SNORA57
Pongo_pygmaeus
Mono:257:SNORA57
11
SNORA57
1001..1149
2149
CCTGCCTCAGCCTCCCGTGTAGCTGGGACCACAGGTGCCAGCCACCACGCCTGGCTAAT
TTTTGTATTTTTAGCAAAAACGGGGTTTCGCCATGTTGGTCAGGCCGGTCTCGAACTCCC
GACCTCAGGTGATCCGCCCGCCTCAGCCCCCCAAAGTGCTGGGATTACAGGCGTGAGCCA
CCACCCCCGGCTTTCCTGAGATTCTTAACAGAATCCAAAACCCAAGGAAAGGTTGTCTGC
TACAGGTATTGTGAGAGGCTAGCAGAGCTTAGGAACTAACAGCCGACAGACATTCCCCGC
ATAAGCGGCAGTGCACAAGGTGAGCTGAGAGGTGAAGCTGCTCCGGAGCTCTGCAGGGAG
GAAGGAAGACTCGGTGGGGACGACCAACAGGAAGAGGGTCTAGTACTCACGCCCGCTTCT
TGAGGTGGTGCCGCGTGATCAGCCCTTGGTCTATTACAGCCCCGACCACCCGGTGCCTCA
GACGCCGCTCCCGATTCAACACCCGCCGGCGTTTGAACAGCTTCTTCTTCAGCTCCTGCC
GGGGAGAAAGATGCGAATCAGATGGAGTGGGCTCGCCGCGACCCGGGACCCCTCCACCAG
GCAGCCCCGGCCCCCCACTGATCCCATCTCGTGCGAGATAAAAGGGCTCGGGGACGCTTG
AGGAAACAAAGTCGCGGCCCCCACACAGTCACCGTTCGGGGCCGGTTGATCTTTCCCCCG
GGAGCTCCCATAGTCGCGATTTCACGCCAGTTCACGGTCCGTACTTCCGCTCAGCGCCGG
ATCCGCGGGGCTCCGCCCCGGCCTTCCGCGGGCCAATCGCAACTCGGGGGCGGGTCCTTG
GGCTATATACAGGAGCTCCGCGGTGCGGGAGGTCTTTTGGAAAGCGATGAGCTAGTAAGT
GCGGTTTTGGCTGTAGTAGCCAGATTGGGCGGCCGGGAGTGGTGGGGGTGTCGGGAGGAG
TGGAGGTGCCAGGTGGAAGGCTCTGGGCGGGGCCTCAGGACCCTCCTTTTCTTGGCGGGG
ATCGGGCTTGTGGTACCGCTCCCCGTAATGTACGGAGGAAGAGGGAAAGGGCTCTGGCCC
CCTCGGCGTCATGTCTTCGGTGCTGGCGGCTTCCCATCCGCTGGTTCTATCCTCAAGCGC
CGGGACACCGGGAATCTCGGAGAAGGACAACCGAGATCCAGCTGGCTCCTCCATCGGGGT
GCTCACACTTTCTCATTTGATTTCAGGTCTGCGGACGCTGTATACCCTCTTCCACTTCCC
GCTGCAGCCAATAAAGGCCGTTCCTACCATAGTCAGTCTGTGTCCACGTTCTTTTTTCCG
AGACTGCAGAGTTTGGGGAAGCTGTACGCCGCCTTTCGCTACGCGTAATTTGCAGATCTT
CCCCTGGACCTCAGGCCTCTCTGGCTGGAGTAGGGTGGACGCTTCACATAAGGTTCTCTG
GTCGAACTTACCCGAACCTCCAGATGGCCGCGCTGCGTCGAATGCTCCACTTGCCGAGGC
TGACGATGGGGACGTGCCGCCCCTTTGCGGGTAGGGAGGTGGGGGCAGAGTGGGGAGGGC
AAGGTGGGGGAGAGTGGGGAGAGTAAGGTGGGTTCCTCGTGACTCAGGAGTGTAGTCCCT
GAAATTGTGATTCTCAAACCCTACGGTGGGCCGTGCGCGGTGGCTCACGGCTGTAATGCT
AACACTTTGCCAGGCCAAGGCGGGCAGATCGCTTGGCCCAGGAGTTCGAGACCAACCTAG
GGCAACATAGCGAGACCCTGTCTACAAAAAAAAATTAACCGGGCATGATGGCGCCTATAG
TCCTAGCTACTCAGGAGGCTGAGATGGAGGCTTCAGTGAGCCATGATTGTGCCACTGCAC
TCAACCCTGGGTCAGAGTGAGACCCTGTCTCAAAAAAAAAAAAAACCCCAGTTTGTATAT
ACGCTGTTTTTGCAGTGGCGAGATAGACCAAGTGACACCCTCCAACCGTGCCCACAGGCT
CACTGGCTGATAGTTGCCTGGCGGACCGCTGTCTCTGGGATCGGCTGCATGCCCAGCCTC
GTTTGGGCACTGTCCCCACCTTCGACTGGTTCTTTGGATACGAGGAAGTCCAGGGGCTCC
TACTGCCATTGCTGCAGGAGGCACAGGCTGCCAGTCCTCTGCGAGTGCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved