Pongo_pygmaeus Locus Mono:139:SNORA26
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:139:SNORA26
Pongo_pygmaeus
Mono:139:SNORA26
2a
SNORA26
1001..1117
2117
CTGCAAGGGCTGCAAGGGCTGCAAGGGCTGCCAGCACGCTGTCACCTCTCACTACCTCA
GTACCGTCCCTTCTCATTTTTCTTCTGCTGGAAACACTTCTACTTCTTTCTTTTTTTGAG
ACAGGGTCTCACGCTGTTGCCCAGACTGGAGTGCAGTGGTGTGATCACAGTTCACTGCAG
CCTCCACCCTCTGGGCTCAAGGGATCCTCCCACCTCAGCCTCCTGAGTAGCTGGGACTAC
AGGTGTGTACCACCATGCCTGGCTAATTTTTTTTTAGTTTTTTGTAAAGATAAAGTCTTA
CTAAGTTGCTTAAGCTGGTCTTGAACTCCTGGGCTCAAGCAGTCAGCCTGCTTTGGCCTC
CCGAAGTGCTGGGATTCCAGGCGTGAGCCACTGTGCCCGGCCCTTCCTTTGTATTTTGTA
CCTGTTATTACATGTTTCTCCAGTTACTTTAACTATTTAACATATCTGTCTCTTCCACTG
GCCCCTGAGCATCTTGAGGGTAGGGATTATGGATTATTCATGTCTATATCCCTAAATGTA
TCACATGGTAGGTGCTCTACAAACATTTGTAGAGTTGAATCAAATGGAACATGTGAGGTG
TACACTTGTGCAAACAGATTGAGCTTCTTTTCTGATAATTTCATTTTGGTGTAAGTTTGC
TTTCAGTTTAAGTAGTCAAAACATTTGGATAGCTATTCTTTTTTTTTTTGGATAAGTATT
CTTGAGTGGACTAAAAATAGCTTTTAATTGATTTCTGGTGCCAATGCTGCAAAACTGGAA
ATCTAAAAGATTTTATCCTTTTATTAGAGTCCGAAGAAGAAAAAGAACAAGGGAGGGGAA
ATGCTTTTAACATTTTATCTGCCTCCTTTCCTGTGCCTTTTTTTTTTTTTTTTTTTTTTT
TTTGAGATGGAGTCTTTGTCACCCAGGCTGGAGTGCAATGACGTGATCTCGGATCACTGC
AACCTCCGCCTCCCAGGTTCAAGCGATTCTCCTGCCTTCCTGTGCCTAAGGTTAACACAG
CGCCTTAAGAGGCTAACACAGAAGGGCAAAGTAAGTCTCCATAAAACCCAGAGAAGACTC
TCTGAACCCCTCTCTGGATCCTGTCTGGAGTCACAGCTGGAAAACAAAAACACACTTATC
TGTTAGGAATAAAGAAATTTAGAAGAAGCAGAAAAGGAAAAATGATTTTTCAGATCTAGT
TTTTCGTTCTTCCAAAAGGAGGAATTTAAACATGAGGGAGACTAATTTATTTCCCCTTTT
TACTTTGGGTTTCATAACTCAACAATCTTCCCTGAGGCCCCAGGTGAGAACAGTGAGTTA
GCTATGAAGGCAGAAATAAGTAACTAAAGCTCTTAGGTGGTTAATATTAACTGCCTTTTC
TTTCGTGAATAAACCATATCACCTGGGATTAATGGGTGAAACGCAGAGAACTATTAACTA
AACCAGGGATTGGCAAACTTTTTCTGTAAGGGCCAGATGGTGACTATTTCTTAGCCATAG
TGATGCAAAATCAGGCAGAGAAACATGCAAACAAACGGGCGTGTAGCTGTGTTGCAATAA
AACTTTATTTACAGCAACAGTTGGAAGTCAAATTTGGCTTGGTAGCTACAGATTGCTGAC
CCCTGAATGCAACACTCCATTTTCAGGTCTAAGTATTCCATTCTCTTAAACACACCATCT
TAGCTCAGGATGCTCTAACAGAATACCACAGACTGGATGGCTGAAAGAATAAACGTTTCT
TTCTCACAGTTCTGGTGGCTGGGAAGTCCAAGATCAAGGCGCCAATAGATCCAGTGTCCT
GCGAGGGCTGTCTTCCTGGTTTGCAGACAGCCTTCTTCTTGCTGTGTCCTCACATGATAC
AGAGAGAAGAAAGGGGCAAGCTCTCAGGTCTCTTCTTATATGGACACTAATCCCAGTCAC
GAGAGCTCCACCTCATGACCTAATTACTTCCCAAGGACCCCACCTCCTAATGCCAACACA
CTGGGAGTTAGGATTTCAACCTGTGAATTTTGGAGGAACACAAACCTTTGGTCCGTAACA
CACAGCATGCTTATATAAAAGGAAGAGATGTCCACCAAAATTGTAAGGTCCATATGGCAT
AGGGACCAAATTATTATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved