Pongo_pygmaeus Locus Poly:27:SNORD115
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Poly:27:SNORD115
Pongo_pygmaeus
Poly:27:SNORD115
19_random
SNORD115, SNORD115
1001..1081, 4927..5006
6006
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTATTTCTGGG
GTACTGACCATTTTGCTCCATTATGCATGAGCCATATAACTATGGGAAATAATGTTTTCC
TTTTTGACACCTGGCCTAGTCCTCTCTTCTTAGATAAGAGCAAAGGAAGAGCACCATTTG
GCCTGCTGCACCCAGGGCAATTTATACCATCCAGGTATCCAGCACTGAATATGTAGCAAC
TCCAATCCACCATAGAACATTAGTCTATCTCTGATAAGCATGCTAATATCTACGATTCTG
CCTTTGTGGGGAGATGACTCCACAGATTAACCCCCTGGCTTGGGTCAATATTGAGATGTT
ATATTGTCTTCAACAGGGAAGATGACATAAAAATTATGTCGAATAGGATTATGTGGAGAC
TTAACATAAGTGACTAACCTGAGACAAGAAGTTAGAAATACTTGTTTCTTTTAGATGAAT
AATTTTGGAGCTTGAGGAAATGACACCGTTGTGGCGAACTTGCTTTGCCAAACCCTGTGT
ATGCATTTCTGGGTAAACAACACATTTTCATCCTTTAAGCATTGTTTCCATTATTTATAA
TTCCTAATAGTATGAGACGTTTGGGACTCATTCCTTGGTTCTTCTTCTCTCATTGTATCT
TTCATTGGATCTTTCGGTGCTGCAATTTCAGAATTGCAAATTCATCAATGAATTAATGAA
CAGAGTGACTGCCTTCGTCACACATACATTCGAAATAGACCACTGGGCTAGTGATGATTC
ACTCTTAAGGCTATTATGTTTACTCATTTAAAAAATCTGAATCTCAGTATGAATTTTCTT
CTCAGTGAGTGACTGACCTATCTGATATGATGCTATGACAAAATCTTTACTTTTTACCTG
AATTTGATGGGATTGAAAGTTGAGAACATTTTAATTTATTTTCTGTTTCACTTGATTAAT
AGTGCCCAATCTAACATGCAATGTTCACTTGGGTACATATATACGACTACATCAAATTTT
TTCTTATATTACCTTAAAAATTTTAAGATATTGTAATGGTATGGCCAGTTTACTCACTGG
TAAACTTTTCATAACAGAAATATCATGCCAGTGGATACAAATACGTAACATCAGTAATTT
GCTTTGCCCATGAAACAGAGAACTGAATAAGTTGATGGGTAAACTAGTATCTGAATTATA
AACTCCAAATATCAAGTGACTTCATCATTTTCAGTATAATGAAAATACAGGCTGTGAATG
CTTCCAGTTGGTCCTGAAAGGGCCTTTGAGGTGAGTAGGTTCACCAAAACGGCGACATGT
GTATCCCAGTGTGCATTCTACTCCTCAGTAAGTGATTGGACATTCTTTATGGCTTCCTCA
TGGTTAAAACAAGTCTTTTTATTGAAATTTTACTGAAATAATGATGAGACAATGTAATAT
TCTTTTCATTTACATATAAGAGTAGACACAGATTCACCTCCACATTTTTTTTTTTTTGAG
ACGTAGTCTCGCTTCGGTTGCCCAGGCTGGAGTGCAGTGGCACGATCTCAGCTCATTGCA
GCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG
CTCACGCCTGTCATCCCAGCACTGTGGGAGGCCGAGGCGGACGGATCACGGGGTCAGGAG
ATCGAGACCATCCTGGCTACCACAGTGAATACCCATCTCTACTCAAAATACAAAAAAGTA
GCCAGGTACGGTGGCGGGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAGAAT
GGCGTGAAACCGGGAGGCAGAGCTTGCAGTGAGCCGAGATCGCGCCGCTGCCCTCCAGCC
TGGGCAACAGAGCGAGAGTCTGTCTCGAAAATAAATAAATAAATAAATAAATAAATAAAT
GAATGGAATGTGGAATGAAATAGAAATGAATGTGGAATGAAATTGAATGGAGTGCAATGG
AATGTGGAGTGGAAAGTGGAATCGAATGGAATGGAATTTGGAATGGATTTTGGAATGGAA
TAGAATGGAATGTGGCATGGAATGTGGAATGGAATGGAATGGAATGTGGAATGGAAAGTG
GAATGGATTGGAATGGAATGTGGAATGCAATGTGAAATGGAATGTGGAATGGAATGTCTT
GTAGAAAGCTAAGGCCTGAGGATTGGAATGCGTAGGAGTATGCGAGGCGTCAGCGGGCCG
AGATGAAAATGGTGGAACAGATAGCAGTGACTTGTTATTTGCCTTCAAGGGGAATTTATT
TTGAACTTGAAGTAACAAAATCTTTATGGGTAACTTGTTTGCCCAACTGTATCAGTGCGC
CTATAAATGAACAGAAAATTCTCAGCCTATAAGCTTGCAATTTCTAATAGTATCGTATAT
TCAGGTCTCATTCTTTGGCTTTTTCTCTTATTGTGTGTTTCAGTAAGACGTGCTGCCAAG
AGATGTGCCATTCTATTATAAAAGATTAGTAGCTTCCTTTACCGACGTGTATATTCTATC
TAGAATATTGAGCTACAGAAGACTCCCACCTAAGGGAATTAGCTTTACACCTTCAGATAA
TCTGAATTTCAATATGAGTTTTCCTTTATGATATAATCCTCATGACAAAATCTTTACTTT
TTATCTGAACTTCATACAATTCAATATTGAAGATTTTTTAAATTCACTGTTACCTAGTCC
AATATTTAATATACATTTGGCTGTAGATACATGTTGACTAGACAAAATTTTTTTATATTA
TTATTGTGGGGCTCTAACAGTGTTTCACTGTAACTGTGAGACCATGGTAATGGAAGAGAC
CCTGGTAACGGAGAGGAGAATGTGAGAATCAGTATGTACTTTGCCTATGAAACTTAAATA
TTTAGTAATTTGATCACCAAATTGATACCCAAATTTCAGTTCCTATCATGTGTAAATCAA
AAAGTATCTGAGATTTAGAAGTTTATTTAGAAGTTGATTTTGCCAAGGTTAAGGACATGC
TCAGAAGAAATAAACCCAAAATCACAGAAACTGTCTGGGATCTATGTCTTTCTCCAAAGA
CGATTTTGAGGGCTTCATTGTTGAAAGGGGAAAAGTGGGCTGGAGGGGAAAAAGGGAGGG
TATGATAATCCATATGTTCCAAGACAAAAGGAGCAGGTAGGGGAATGGTCAATAATGCAT
TCGTCTCACGCTCAGTAAATCAGCACTTTACATAAGATAAGGTGAACACAGAGTAGCTAC
CTGTGGAGATCTTTAACCTTTAATCTGTAGCTATCTGCTTAAGAACAAAAGGAAATTCTT
GCATGACTCAGCTTTCAGCTTATTTTTTTTTCTTTTGGCATAGTAAATTGGGGTCCCCAG
TTTTTATTTTCCTTTCACACATGTGACCCCACTATTTTCAGAATAATGAAAGCACATGTT
AGAAATGGTGACACTTATTCCTAATATGGACTTTGAAATGACTGGGTTCACAAATTTAGA
ATCATGGCTCTCACTGTGGGTTTTTATTTTCAATGAGTGACTGGCTTACTTGATGGAATT
CTTTCAAAAAATGTTCACTTTTTACTGAAATTGTATTAAAATAATGTTGGAATATGTTCA
GTCATGTTTACCATCTCTATAGTATGATATATGATAATATGGCAGATTACTCAGTGTCAA
AAGCCTGGCATACCTTGTCCTTATGATGTTGATGAGTCAGTGGTCTAGAGCCTTAGTAAT
ATGTCTTTTTGTGGTAGTATGGACCAAATCTCTCCACCAAGAAATAGCCTGTGTAAGCCA
TATACGCAGGAACAATTTATGTCTGATTTTGAACTATGGTCCCGTTCCTATGCCTGTAGA
TAAAGACTGCTGAGAAGAGCACCCTCTGGTGTTGCCACAGAGGCAAGTGCTACCACACAG
GCATGGTGCAGTGAATTTAACTGATCCGTTGTTTAAGGATGCTATTCTGGTAAGGGTTTA
TAAGACAATGTAACTATATGTATAAAGAGTATCTTCAGGAGATGTAATAATGTAAAAATC
ATGTTCAATAGGATTAAGCTGAGGCTCAAAATAGTGCCAATCCTTGCAAGAAGGTGTGAG
AAGTCATTAGATTTGGGGGATATGGGGTATTCCATTTTCAGCTTGGTAGGAAGAAACCCT
TTGGGGAATCCCGCATCATTTGCCTCTATCTACTTCTAAAGGAACTTTTAAAATTCTTTT
ATCTTGTCTTTATTCTTAATACTCATACATTATTAGAGAGAATATCTTGATTTATTTTTT
CCTCATGGTGTGCTTCAGAATGTTCATCCAGCAAGAGGTGTGTCATTACATGGATTATAT
ATATGAGTTCTGTCTTTTGTAATTAAAAAATTCCAAGTGGACCATTTGAATATTAAACAT
TGGCCTTCAAAATGATTACATTTACCTGTTCATACAAAATTAGTGAGCAATGGTCCATTC
TTTCCAATGAGTGACTGGTCTAATGGGGTCCTCATTAAAACTCCTTTTTTTTTTTTTTTT
TTTTTTTTTTAACCTGAGCGTACTTTGATTTAAAGATGAAACATTTGGTAATTCATTGCA
ATCAACTCTTTAGTGATTGCACAAATAGACAATCCATTTCTATTATTTTATTTTTTGAGT
TGCTGTATATGGTGTTATGATGTTTGTGGATCATTGAGGCACTACTCACAACTAAAAGAC
TTTGGCAATTTTAGGGAATGGCTTGAGATTCAGCTATAGGTTAACCTTGATTGAAATTGA
ATACAATACAGGTAGTCTGAAATCTCATTTCCTTATCCTGAGTCTCACTCAGTGTCATTA
AATTTGTTATAAAAGAAATGCATACACCTATGTACGATGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved