Pongo_pygmaeus Locus Mono:56:SNORA4
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:56:SNORA4
Pongo_pygmaeus
Mono:56:SNORA4
X
SNORA4
1001..1147
2147
TCTGAACCTTCCCAAATTGATCTTGGGGGTAACATTACCACTGTAGAACCTAAGGTCAG
TGCTTGAGATATTTTACAGACCCTGCACTCGATGAATTAGCTGACACCACCCAGACTGGT
AATCTGACTCAACCAGTTCTGCAATCCCAACCAGAAACAGAATACAGTGAGGAAACGTCA
CTTTAGCCCCCTATGATTCCATCTCCAACCTGACCAATCAGCACTCCCCACTTCCTGAGC
CCCTACCCACCAAATTATCTTTAAAACCTTGATCTCTGAATGCTCAGGGAGACTGATTTG
AGTAATAATAAAACTCCACTTTCCTACACAGCTGGCTCAGTGTGAATTATACATTCTTCA
TTGCAATTCCCCTGCCTTGGTAAATCAGCTCTGTCTAGGCAGCCAGCAAGGTGAACTTCT
TGGGTGGTTACAATTCCAGTTACTTGGGGGGCAAAGGTGAAGGATCACTTTAGCCTACGA
GGACAAGGCTGCAGTGAGCCATGTTTGCATGACTGCACTCCAGCCTGGGTGACAAAGTGA
TACCCTGTCTCAAAAAAAAGAGGATGAAAAAAGAACAAAGAACGAATGAATGATAGAAAT
ATTATAAGGTGAATATATCATCATGTATATCATATCATAGATATAGCATAATATTACTTT
AATATGAGGTCCAATATACTAACTAAAGATAGAATTGTCAGAGTGGGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNAGACACTTTCTTGTTGGACACAGATAATTTAAAAATAAAGAGGTAA
AGAAAGGTATACGGTGTTAACATTTATCAAAACAAAGCATGTTACCAAAAGTTAATGTTT
TCAGAGAATGCTTTTGTTAAAAAGCCTTTACCAACTTGGGCTGTTTGGGATAATAATGTT
GACCACTTTCCACAGTGGGTTATAACATTAATATACATATAATTCACTACTAGTTTGTAA
TCTACATTACATAAGTGTAAAAAAAGTGTGAGTAGCTATATTATTTTTCTGAAAAGGCAG
ACTTCAGAGAAAGTAAAATGATCAGAAATGAAGAGGCATTTTTAAATGATAAACGGTCAA
TTCTCTAAGAGAATATAACAATCCAAAACATGTACACACCTAAAAAGTGGAGTATATGAG
GCAAGAACTGATGGCACTGCAAAGATAAACAGACAAATCTACTTTTATAGTTGGAGACAT
CAACAACTCAATGTAAGTAATTGACAGATTAAGCAGGTAAAATATCAGTGAGAATAAAGA
TGGCCTGAGCATCATTTCAATCAATTTGATCACTTAGCAGTTATAGAATTATCCATATGA
AAAGAGCATAATACACATTCTTCAAAAACACACATGAAATATTAAAAAGACCACATTTTG
TGCTATAAAACACATCTTAACAAATTTGAAAGACTGTATCAAATAAAAAATAAAGTATGT
TCTAGACCACAGTAAATATGAATCAATTTTTTAAAAATTTACTTTAAATATTAATATGTT
TTCAAATAACCCACGGTTCAAAAAAATTAAAGATAAATGTAAAAATCATTTCGGATACAT
GAAAACAAAAATATAATCAGAATTTGTGGGATGCAAAGTTAGCCATTCTTAAAGGAAAAT
GTGTAGCATTAAATTATATATTTGCCAGAGCAATCAGGCAAGAAAGTAAAAATGGCATTC
ACGTAGGAAGAGAGGAAATCGAATTGTTCCTGTTTGCAGACAACATGATCCTGTATCTAG
AAAACCCCATAGTCTAAGCAGAAAAGCTCCTTCAGCTGATAAAATACTTCAGCAAAGTTT
CAGGATACAAAATCAACGTACAAAAAATCACTAGCATTTCTACACACAAACAACAGCCAA
ACAGAGAGCCAAACCAGGAAGGTAGTCTCATTTACAATTGCCACAAAAAGAATAAAACAC
ATAGGTATTGCAGCTAACCAGGAAGGTGAAAAATCTTTACAATGAGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved