Pongo_pygmaeus Locus Mono:210:SNORD65
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:210:SNORD65
Pongo_pygmaeus
Mono:210:SNORD65
8
SNORD65
1001..1073
2073
GCCTCCCAGGTTCAAGCGATTCTCTTGCCTCAGCCCCACCAAGTAGCTGGGATTACAGG
CGCCCACCACCACGCCCAGCTAATTTTTGTATTTTTAGTAGAGACAGGGTCTCGCCATGT
TGGCCAGGCTTGTCTCGAACTTCTGACCTCAGATGATCCACCCGCCTCGCCTCCGAAAGT
GCTGGGATTACAGGCGTAAACTACCACGCCCAGCCTTCACGTAGTTATTTATAGCAGTGT
GAGAATGGACTAATACACCCCTTCAAAAACATGGAAAACATACACCTATGCTGTGACTCA
ACTGAGAAATAAAAACATGTTTATGCAAACACTTATATAAGAATGCTTATAGCAGCTTTG
TTCTTAATAGTCAAATCCCGGGTATTAATAGGAGGCTGGAATAAACAAACTGTGGTTTAT
AAAATTACCCTTCATTAAAAAAGAATGAGCTACTGATACATGAAGCAGCATGGATGCCTC
TCAAAACTCTTAGGCTAACTGAAAGGAACCTCGCACACAAGCGTGCATGCTGTACAACTC
CACCTATGGGAAATTCTACAACAGGCAAATCTAATCTACGATGGAAAAAATCAAAATAGT
CGTTATGTCTGAAAGGGTAAATTTAAGAATTGACTTGGGACAGCCAGGTGCAGTGCTGTG
CACCAGAGTTCCAGCTACTTGGGAGGCTGAGGTGGGAGGATTGCGTGAGCCCAGAAGTTT
GAGGCTGCAGTGTGCTGTGATCACACCACTACATTCCAGCTTGGGCAACAGAGCAAGACC
ATGTCTCTGAAAAACAAACAAATAATTGACTAGGGAGAGCATAAAGAAAATTTCTGAAGT
GACGGTGTTGTTTTATCACTTGATATGGGTTTGCATTACATAAAAGAATGCATTTTTCAA
AATGTACATTTAAGATTTGAACATTTCATTGTATCTGAAGTTTACATTAAATGAAATATA
TATATATACACATACACATATATATGTGTGTGTGTGTGTATGTGTGATGAAATCACCCCA
AATAGTTGGAATTACCAGCAGATTGTATAGTGGTGAACCTACAATTTTCTGAAGAAAAAG
AAATATACTTAAAAATAAATATTGAACTCAATAATATGCATGTTTACATATGCGCTGATG
TCTTATTTTACTTTGAAATGGATGGATAATGGAAAAATGCATATTGAAACACATGTAGCA
AACTGCTTATGGTGAAATCTTGGCAGTGGGTTTATGAGTTTTCATCATAAAATTCTTTAA
CTTTTCTGTATACTTACAATTTTTCATAAGATATTGAGAAAAACCTTGAAAAACAAAAAT
ACAAGAAAATGGGACTTTGAGGTAATAGAAATTTTCTTAAGACAAAAATGCATAGAAGAT
ACATTTTACCACATTAACATAAAGAAACATTGGTCAGCAAAAGACATCGTGAAGAAAGGG
AAGAGTGAAAATAACAAGCACCTGTAATCCCAGCACTTTGGGAGGCCAAGGCGGGCAGAT
CACCTGTGTTCAGGAGTTCAAGACCAGCCTGGCCAACATGGCGAAACATTGTCTCTACTA
AAAATACAAAAATTAGCCAGGCGTGGTGGCACACACCTGTAATCCCAGCTCTCAGGAGGC
TGAGGCAGCAGAATCGCTGAAACCCAGGAAGCGGAGGTTGAAGTGAGCCAACATCGCACC
ACTGCACTCCAGCCTGGGCGACAGAGTGAGACTCCATCTCTAAATAAATAAATAAATAAA
TCTGAATGATCTATGTGGGTCCAATGATACCATCACGTGTACTTATAAGAGGGAGTCAAG
GGAAACAGAACTACCGAAGTGGAGACGGCGCTGCAATGATGCCAGCAGGTGCTGGATGGT
CACTGTCAGGGACTCCAGGCAGCATTAACAGCTGAAGGGAGCCGACGGTCCCCTCAGAGC
ATCCAAAAGGGGTCATTCCTGCCAACACCTTGCCTTTCACACAGGAAAACTGCTGTCCCG
ACTTCTGACTTCCAGAGCTTAAGGGAATACATTTGCATTGCTTTCAGCCACGAAGTTTGT
GGCGATTTGTCACAGCAGCAATAGAAATCTGACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved