Pongo_pygmaeus Locus Mono:142:SNORD23
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:142:SNORD23
Pongo_pygmaeus
Mono:142:SNORD23
18
SNORD23
1001..1104
2104
AGGCACAGGAGGATTGCTTGAGGCCAGGAGGTGCAGTCCAGTCTGGGCAACAGAGTGAG
ACCCAGTCTCTACAAAAAATTAAAAAATTAGCCATGCATGGTGGCACATGCCTGTAGTCC
AAGCTGCTTGGGAGGCTGAGGCGGGAGGATCGCTTGAGCCCGTGAAGGGGGTGGTATCAA
GCAGTCAGCTATGATCACGCTACTGCACTCCAGTCTGGGCAATAGAGTGAGACACTGCGA
AAAAAAAAAAAAAAAAAAAAAGGAAGGAAGGAAAGGAGGAAGGGAGGGAAGGAGGAAGGA
AAGAAAGGGAAGGAAGGAACAAATGAACAAACCGAGTTCCAGGGAGAGAGAAACTCACCC
AAGGTCACTCAACAAGGTTGTGGCTGAGCTGAGACTTTTGAATCCAGTACCAATGTGCCT
TCCTCTAGACCCCCTTACTGCTTCCTGTGGTGTTAGTGACAAAATACTTAGGACAAACCA
TTTCAAATGAAAGATCAGCTGGCAAGCTTGAGCTCCACACTCATCTTGACAGGCTAAGAT
TTAAATTCAGAAAATCATACAACTAGGGGCTGGCAGTGTTGCCAAATCTTACAACCACTC
ACCTAATGATGTGGTTTTGAAATGTGATGCCAGGAAACTGACCTTTCCTGTGATAAGCTC
ATAACTAATTTCTTTCAAAAACTCACTTGTGGTGAGCATGCTCTCTGCCAGAGCTCGGGA
CTGGTGCTGACCTGCAGGATGGAGGGGAGAAGAGAAGACTCATCAACAGAACAAATGTTG
CTGGAACATTACTTATAATGGCAACAATTGGAAATAATCAAAGGATGTCACTATAGAGAC
TTGGGTTAAGAAAATTATGACACATCAAAAGGTGTGGACAATTATACGGCATTTGAAATA
TCAATTCTGACTCTAGACAGAAACAGAAATGTTTATAATACAGATGATCGAGGAAAAAAA
ATGATGTACGTTATGTTTGTAACTGAAAATACGCACGTTTGTGTTTAATGACTAAGGAAG
GTCCGGGTCCCCCCCAGGGGCTGTGAGCAACACCATGGCTGCCCCAGGGCTGGCCAACTG
GGCAGATGCCCAGGGGCTGAGAACATGGGGGAAAAACAGACTAGGGAAGAGTATGAAAAA
CCTTATAAAAATTGTGCTTGCGTGGTTATAATGAATTTGCCTTAAAAATATAAACATGGA
TTGTTCCTTATTTTTCATAAAAATGAAAAAATATTAATGTATCACACTGATGAAGCTTTC
TGGAAATACATGTAGCACAGAAAAATGGGCAGACAGGTTTTGTCAAAGTGAGGGGGTTTC
TTAGCTTCTTTGCTAGAAGAGGTGAGAGCCTCTTCAGAGAAGAGAGAAGCAAAATGTAGT
TCAAATGACTACCCAGGAAGGTGCCTGATAGAAAATCTGCACAGTGCAAAACAAACAAAA
ATCCCCTCCCACTCCCCAGTTTGGTAGTGTACCAACTTTCTGAATCTTTTCTTTAGAGAC
TATGTTACAATATTAAATAGACTGTCCAGTGAGAAGGGGAATATATGAGCTACTTTTCTG
GCAAATTCGATTAACTGGCTTAGGCCACCTGTGGCACTGGCTTTATCACATGCTAGAGTA
GTAACATTTCCAAAATCTTTAAAGGACAGCAGTTACATGAGACAGAGGTATCTGTTACTA
GGGAGAGCTTTGAAATAATGCTTCCACAACCAGCTGACAGGGGCACCAGCCAAACTGAGG
GCTACACAAAACCTGATCTGAGAAGGAAAGGGAAAGTTAAAATTAGAAGGATGAGCCCAA
GCTCCAGCAATTAATCAGAGGTTGATTATGTGGATGCCTGAAACACATAATACACATTTT
TAAATGGACAAATGGTCAAATGAATTGATTAAACAAACAAAAAACAAAAAAATTACTCAC
CTAACACTACCACACAAAATTCATTTCCTCTGATTTTCGATGCACAGATTGCCACCACAT
AATCTGGCAGCCTTTGATAGTGTCTCATTTCACTGAGAGTCCTTAAGGTCTCTGAAATGC
CCTCTGCCAAAGAGTTCTGGGTCACAATCACATGAACCAAGTCTTGAGATACGCTGGCAA
TTAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved