Pongo_pygmaeus Locus Poly:31:SNORD115
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Poly:31:SNORD115
Pongo_pygmaeus
Poly:31:SNORD115
15_random
SNORD115, SNORD115
1001..1082, 2548..2629
3629
TTTTCCCTAAGTGTTGGCCGGTCTGAGAAATAAAGGGAAAGAGTACAAAAGAGATAAAT
TTTAAAGCTGGGTGTCCGGGAGAGACATCACATGTCGGCAGGTTGCATGATGCCACCCAA
GCTGCAAAACCAGCAAGTTTTTATTAGTGAATTTCAAAGGGGAGGGAGTGTACAAATAGG
GTGTAGGTCACAGAAATCACATGCTTTACAAGGCAATAAAATATCACAAGGCAAATGGGG
ACAGAGCACTGAGGCTAAATTAAAATTGCTAATGAAGTTTCGGGCACGCATTGTCATTGA
TAACATCTTATCAGGAGACAGGGTTTGAGAGCAGACAAGCGGTCTGACCAAAATTTATTA
GGCAGGAATTTCTTCGTCCTAATAGGCCTAGGAGCCCTATGGGAGACCGGGGCTTATTTC
GTCCCTTATCTGCAACTGTATAAGACAGACATTCCCAGAGCGGTCATTTTAGAGACCGCC
CCTAGGAAAGCATTCTCTTTCTCAGGGCTGTTCCTTGCTGAGAAAAATAATTCAGCAATA
TTTCTCCTATTTGCTTTTGTAAGAAGAGAAATATGGCTCTGTTCACCCGGCTCTCAGGCA
GTCAGACCTGATGGTTATCTCCCTTGTTCCCTGAACATCACTGTTATCCTGTTCTTTTTT
CAAGGTGCCCAGATTTCATATTGTTTAAACACACATGTTTTACGAACAATTTGTGCAGTT
AACACAATCATCACAGGGTCCTGAGGTGACATCCTCAGCTTACGAAGATGACGGGAGTAA
GAGATTAAAGTAAAGACAGGCATAGGAAATAATAAGAGTATTGATTTGGGAAGTGATAAA
TGTCCATGAAATCTTCACACTTTGTGTTCTGCCATGGCTTCAGCAGGTCCCTCCGTTCGG
GGTCCCTGACTTCCCACAACACTGGTCTCTTGCACTGAGCTTTGGTGAGCCCATCTAGGT
CCTGCTGGATGCATGTGTAGGGAGGGGGGGTGCCCTGGGTTGGGTCAATGATGAGAACCT
TATATTGTCCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTATGCTGAGG
CCCAGCCTAGGTGAGAATTTTGGAAGAGGATGCTGAGATCCCAAGGTCTCTGGCAGGGCC
GCTGTATTTTGGGCTGGAGACCTGGAGGCCCTGAAGTGCATCTTAGGGGTGCCCGACCCT
ATCTCTGTGTTCCTCCTTGAGGCAGCCCAGGCTCCCTTGTGGGCTTGGTGTCGGCCCTCT
AGTTCCCCCGGGTTGAGGCACATTGGAGGCTCCATCCTGAGCCCNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTGTGGCCCTGG
GGCTCCAGGATTTGATTTCTGGTGTGAGCTTGTAGACGGGGTCTGCAGTGGCACATGGCA
TTCAGGTCAGCCTACTTGGTTTGCTGTGAGCTGGTTGGTGGTCCTGGCCCTGCCCAGTGG
TCCCGTTGTGGCACACAGTCATGCGGGGGAGCTGTGGCAAGGAGGGCCAAGGGTTCCCCA
CGTTCATGACCATCACTGTTTACATGGATCCCATCTCTTGAGTCCTTAGAGGGAGAGCAT
GTGTGAGCCAGCACCCCCTGCCCACTTTCCTGCATGGAGGCATGAGGTCGTGTTTCTATA
CCTGTCCCCAACCCCTCCAGATGGTGACCCCAGAGGAAGACGTGCATTGGGTGCACTGGC
CCCAGGCCAGTGTCTCTCAGCCATGTGCTCAACCCCTGGTGAGCTGAAGCTCAGGCCCTT
CCTGGCATCCTGGTCTCCTGCACTGAGCTGTGGTGAGCACATCTGGGTTCCTCTGGATAC
ATGTGCGGGGAGGGGGATGCACTGGGTTGGGTCAATGATGAGAACCTTATATTGTCCTGA
AGAAAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCTAGGTG
AGAATTTTGGAAGAGGATGCTGGGATCCCGAGTTCCCCAGCAAGGCCACTGTATTTTAGG
CAGGAGACCTTGAGGATCTGAACGGCATCTCCGGGGGGCCCAACCCTGTCTCTGGGCTCC
TCTGTGAGGCAGCCCAGTTTCCCTGTACAGGCTTGGGCTCCGGTTCCCTGAGCCCCCATT
CTCCCTTGTGTCTTTCACTGAGCTCGTTCACCTAGGTGGGGCCCCCAGGCATTGACCGGC
ATAGGTGAGTGGTCCTGCTGGGGTCATGGGTCATCAGCAGCATGGGGTCACCAAGGGTCA
GCCTTTGAGACAGGAGGGTTTCCACAGGCAGCCAACCTGAATCCACACCATGGAGGGATG
GATTGGTCCTCCAAGAGGGCTGTTTTTTTGGGAATCAGACCCAAGGAGGATACCTTCCCT
GCAGCCCTGCAGGGATGATGGTGGTCCAGGCAGGAAAGGGTTCCTTCAGTCTCATGCAGG
GCAGCTCCCAGCTGAGTCTCAGTGCATTGGTCTGGCCTCGAGGACTGACCAGGCCACATG
AGGGGGCCAACAGGGGCTTCGGGATGCAGTGGGGTTACACAGGATCTCTCCATCCCCGGA
GAAAGGTGGGCATAGAACCCATGGATTCGAGCTGCAGAGATTCAGGAATCGCACACGAAT
TATTGCCCAGAATGGGACCGACCTGTTGAGCAATGTGCCATCCCAGGGCACCTCTTTGAG
CCTGAAGGGGGTGGTGCTGTTGCCCTAGGTTTGGGTCAAGGCTGAGCTCTGGCCAGTGCC
TGGTGTGCTATAGTCCTGTCATGGACTCGTTAGCTTTATGCCAAGGGGTCAGCCCACGTC
CTACTGGATATCTCCCCTTCCCTGTGGCTGGAAGTCACCCCTTCCCCATTGGCAAGTGTC
AGGAAGGGTGACCTCCTGAGGTGGAAGGCCTGTCGAGGGTCTTGTCCCTGGAATATGCTG
CCCATGCTGCTTCTGAGCCGTGGGGTCACC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved