Pongo_pygmaeus Locus Mono:82:SNORA17
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:82:SNORA17
Pongo_pygmaeus
Mono:82:SNORA17
12
SNORA17
1001..1127
2127
AAACAAATTAGAAAAGATAAGACAAAATAATTTTCTTAGAAATCAATTCTGACTTACAG
AAACCTGAGGTGGTGGAGGCAAAGAAAGAGATGGTGCTGGAGAAAAATACCCCAATGAAC
ATTCAGAGAAAAATGGCGGTTGCACTGGTGAAGGAGCTGTAAAAAAATTTTTTGTTAAGA
GTTTAATAACAGAAATACTTCATTAGGAATATATTGTTTATGTTATGTTTGAAGAAATAC
ATCTAGGTGGAGTGCAAATTAGATTTTATCAACCTCTGATAAAATCTTTAACCCCCTCAT
GAGTCCATCTCCAGCCATTTAAAATTGTCATATCATCATAAAGTCAGCCATTCACTTTAA
ACTAATAATTAGTCCCTCAAAACTCTCACTTTGTTCCACTTTTAACCTAATGATGAGAGC
AGAGAATAGAGCAGGAAAAGATAGAAACATACTTTAAAAAAACAAACAAACAAACAAAAA
ACACAAGCATACTTTTTAAGAAATAAGGAAACAAAAAATTCCCTTGAATTCTGCCAAAGT
GCCCTAGCCAAAGGAAAACAATGATGTGGTGACTTCATTATTCCCTTCTTGTGGAGCAAA
AGAAAGTTGAGGACATGGACCATATAAGCTGTGCTGAAAGCAAATAAAACTAGGAATGAG
AAGAATTACTTAAGTGTATTTAGTCAATAAGGTGCACATTTTTTCACATTTTAATTTTGA
AATAATTACAATTGATGCATCTCAGCATTTTTCTTCCTTGGTAGCAGATAAAAATAATTG
TGTATTTTATCTTCAATGACTTGTTAGGCTCACTGAAATACAGCAGTTTCAAAGACTACT
CTTACTACCCTACCCACTAACTATATAATCAGAGAAAATCTAACATTTCTTCTTTATCCC
AGTTGTCTCACAAGTCAATACATTATTATCCACATGCCTTATATGTGGTTGACTTGATTC
CCAAATGAGATAATCTGAATATACACTAATCTTTGGAACATTTTACACAGCGCTGCAGAT
GTGGCTGCTGTGTCACATTTGTGTTATTAGGTGGCAGAGAGAAGAGAGGCTATGTCTATG
CTCAGTGTTCTGCCCCATGAACATTTGAATGTTTAATAGTCAGACACTTGATGGTGCTAT
TGTTTTATGGACTTGGCATGTTTTCCCTTTCTAATATCTGGGAGACAGGGTGGACCTAGT
GAGTGCAGTGATCTCCGAGGAAAGCCCTCCAGGCTCCACTGTCCTCATCCAGATTTAACC
AGCCCTGACTCACTGCCAGGCGCCAGGAGAGGCTTCTGAGGACTTTCTGACCTTTGTGTT
GGGCCGGCCACTAGGGGTTCTGAAAGGACAGTGGGAAGGTAGAGGGTGCCCTCAGCAAGA
GTAGCCTTCATTCATGAATTTTAGAAACTAGTGGTAGGAAAGACAAAGTCCATTATGTGC
TGGTTCATGCTACCCACCATGTCAGGATCATCCAGGAAGACAAAGAACTAGGAAAGTGTT
TGCTGGTGTTTGATTCAGTAAATAGTATTAACAGTAGCCCCTTTTACTATGCTCTTCATT
CTGTGTCAAGCTTTCTTGTTATTTATTTTTGAGACAGAGTCTCACTCAGTGCCCAGGCTA
GAGTGCAGTTTTATTGTGCTCTTGATTCTGTGTCAAGCTTTCTTGTTATTTATGTATTTA
TTTTTGAGACAGAGTGTCGCTCAGTGCCCAGGCTAGAGTGCAGTGGCACGATCTCAGCTC
ACTACAACCTCCACCTCCCAGGTTCAAGTGATTCTCCTGCCTCAGGCTCCTGAGTAGCTG
GGACTACAGGGGTGAGCCACCACTACCAGCTAATTTTTGTATTTTTAGTAGAGGCGAGGT
TTCACCATGTTGGCCAGGCTGGTTTCGAACTGTTGACCTCAGGTGATCCTCCCGCCTCGG
CCTCCCAAAAGTTCTGGGATTACAGATGTGAGTCACCGTGCCCAGCCATTCTTGTTTTTT
AACACAGGAAAGAAGTTGACATAACTTGTGATTGGCTTACAGTGTGAGCACTGGCCAGAA
AGACCAGGTGGTGGACTGGCCCCAGCCCAGATCAAGATGCAGAGGCCAGGATGTGGGCCT
TGCCCTGTGCCAGGGGGCTGTTTGGAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved