Pongo_pygmaeus Locus Poly:0:SNORA5
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Poly:0:SNORA5
Pongo_pygmaeus
Poly:0:SNORA5
7
SNORA5, SNORA5, SNORA5
1001..1132, 2075..2215, 2638..2777
3777
TCTTTTTACCCATATGTCAAAGGCTTTCCTGCAAACCTTTGTGCCTGGGGTGCTCCTCC
CTTTGAAGGCAGTTGAGGGTCTGGCGTGCTTGGGTGCCGCGTCCCTGGAGGGTAAAGGTG
GTGGTTCACTGCCTAACGCTCTGCAGGAACTCCTGCTTATTGCAGCAGTTGCGTTCCTAA
GAAACTTTCACGTTGCCAGAAACTGCGAGGTTGGTTTGTTAGAGAACGTTTAGGGGTTGG
AGCTTCTCTGACTCAAAAACAAATTATTTTCCTGGAGAAAAGCCAGTGTTTTTTGTTTTG
TTGTTTGAGACAGAGTCTCACTCTGTCACCCAAGGCTGGGAGTGCAGTGGCACAATCTCA
GCTCACTGCAGCCTCCATCTTTCCAGGTTCAAGTGATCTTCCTACCTCCAGCCTCCCCAA
GTAGCTGGGACTACAGGCATGTGCCACCCACAAATGCCTAAAATACAATGTTTTTGATAA
TTTTAAATAAGGCACAGGGTTTCACCACGTTCACCAGGCTAGTCTCGAACTCCTGACCTC
AGGTGATCTGCCCGGCCCAAGTTTTTAATACCTAAAACTTTTAATGTCATTGCAAGTAAA
AGTCATGAATGATAACAAAACTGATCTTAGCAAGCCTAGGTGCTACCTTCTCTGCCATCA
GGTGACATTCCATCAGGCTCAACTTTTTCTCTGACCTCTTGTATTGACTTGACAGCTTTA
CTTGCAGCTGAAGTCTGCATGCCCACTACCCAGAGCTGTAGCCAGGACCATGTAAAAGAG
TGTGGTCTCTCTTTAATCAACTACATTAGGTCAAAGCTTCATTGGGGAAACTTGGAGAAT
TTCCCTTGCCACTCTAGAGTTCTTGCTTGCAAGCAATTGCAAATGACCTCAGCCACCTTG
AGCAGAAATGTGCTATTTATTGTAGCCTAGAGGATCAGGCTCAGAGGTGTACCCTTGGAT
CTGGCCGTGCCTGAGGGGCGCTCTGGCTTCTGCGGGTGCTTGGCAGCCATGTCAAAATTC
AGTGCCTGCCCTGCCTATGGTAGGCACTGCCCAGAAGACTGCCACAGAGACAGTGACTCA
TGGGCCCTGTTCCTGTGTCCCAGGCTCAGGGATAAATTTGGTTACAGCCACCAAGCGTCT
AGGCCTCGAGGCTGAGCAAGGCTGTGAGGAGCAGCCAGGCACTGGGGCCCTGTTACAACG
GAGTGGGGAACTGATACTGTCTTCTCTGAAGAGTTGTAGTAAATGCTCATGAAACAAGGT
TTCAGAGAGGGTGTGCCTCCAGCTCACACACAGGACCGACAGTGCCACATCATTTTCTAC
CTGTGTCCTTTCCCTGCCTAGATAGCCTCGGTCTGGCATGCTACCCTCTACGAGGCTGCT
GGGAAGCCTGTATGCTCTGGGGCATCCCCAAGACCTCCAAGGAGCTGCAGTCGGTAGAGC
AGGAGGTCCGCTGGCGCATGCGGAAGCTCAAGTACAAGCAACTGGCCTTGCTGGCAGAGT
CCTGTGCCACCCTCTCACAGGAGCAGCACTCGCAGGAGCTGCTGGCTGAGCTGCTCATGC
ACCTGGAAAGGCGCTGGACAGAAATTGAAGATTCCCACACATTAGTGACCGTCATGATGA
AGGTGGGACACCTCTCGAGAGCCACTAATGAACCGCCTGGAAAGACAAGGTACTGCGCCT
GAAAGCAGGTGGCACCCAGCCCTGCCTCCCCTGGGCTTTGGGCTTGTTCTTTGGGTGACA
GTTGTCTGCAGAGGGGTGCGTTGTTGTGCACTGGGATTAGAGCCCCGGGAGCTTCTGTTC
TGGAGCCTCAGGCATCACATGGGGCAGGACCAGAGGGCTCGGAGCTGCAAACAGGTGGTT
GCCCTGTGGCTGCATTTATCAAGCACCACTTGCTCCTTCCCAACACAGGCGCTTTCCCTG
ATTGCACCTTTATCTTTCCCTTCAAACCCCATCATAGCACGATCTTGAGAGGGGGGCCAT
GGCAGGCAGCTCCTGAAGTAACACAGGTACTGCCCAGGCCTGGCTTCTGGCTAGAACTCT
CCTGGAGATGTGCTAACACCTATCGGCTGTAGCCCTGCAGTCAAGTCAAATTCAGTGCCC
GTTCCTGTCATAGGCGGGGGCTGGCCCAGATGGCTGCCACAGCCAAGCTCCACAGCTCAT
GGGCCCTGGATCACCTACCCTGGGACCTGGGGAATTAAGTTTGGCTGTGGACAGTGCTCC
AGGTCCAGGGGTTCCCTGGGGTGGACGAGGAGGCAGGCCCTGCACAGTGGTCTGGTGTTT
AGTCAGCTCAGGCCCAGTTGCTGTCTCACAGGGGCTGCACTGGATGGGACCATGGGACCC
CTGCCCCCAGCTCGTCCCTGCCACCCCAGGCCATTGAGCTGACCTCTGCGCGGCTGTGGT
TGACAGTGCCTGGAGTTGGTGGAGCACTTTGGCCCCAGTGAGCTGCGGAAGGTGCATTGG
TGACGCTTGGCAGCTCAGAGCCGGCGGTCCGTGCCCTTGCTTGCGGGCCATCTCCTACCA
CCTGGTGCAGAAGCCCTTCTCTCTGACGAAAGATGTGCTCTTGGACGTGGCCTACGCCTA
TGGTGAGCCCTTTGGACAGAACGGTGGAGAGAGGGGAGCGCTGGCCCTGCAGATGCCCTG
CAGGCCGTGTTCAAATTCAGTACCTGTCCTATGCATGGTAGGCACTGGGCCCAGAAGGCT
GCCACAGAAACACTGTGACCCATGGGCCCTGNTTCCTGTGTCCCAGGCTCAGGGATAAAT
TTTGGGTTACAGACATCAAAGCATCTAGACCCTCGAGGCTGAGGGTGGGGTGGAGCTGCT
GAGGTGATTACTGATTCTCCAGCTAAACCCCTGTGATCTGCTCTGTCCCGAAGGCAAACT
CTAGCTTTCACCAGACCCAGGTGTCCCAGCGCCTGGCCACCGACCTGCTGTCCCTCACGC
CCAGCCTGACTTCTGGTGAGGTGGCCCACTGTGCCAAGTCCTTCGCCTTACTCAAGTGGC
TCAGCCTGCCCCTGTTTGAGGCCTTTGCCCAGGTGAGCCCAGGGCCTGGCCCCAACTCAG
AGAAGCTGGCTTCCTGGCCATCGGCTGGGAACCATTGCCTTAGTCGGGAAAAGTAAAAGC
CAGTCTGAAAATGCTCACTTGTGGGGGCAGATACATATTTCTTGCATTTTGGCTTATTTT
GAAAGGGCTGCTATTCAGTTCTCAAAAAAGTGTTTGAGAACTGTTTCCTCTCTTCTTTCA
CTGACCATTATAAGTGCTTTCCATCCGTTTTGGGGGTAGCTTGTAGCAGGTAGCAGCATG
GCTGGGTGAGGCTGAGAATCCACTCAGAACTGTCTACTGAATCACTGATCCCCCTCGCAA
AGTGGAACTGTACAGAAAGATGCACACCTGCACGTTACGTTTATGTGTGACCGGGTCTAA
ACTAAGTTTACTGGTTGGAGAATATTTCTAAATCCCTTATCAGAAAGAAGCAGCTTCTAG
GTGTCCCCAGCCTCTGTGAGGTAGTTGCTGCCAGGCGAAGGAGTGTCTGGGCCTGTGTAA
GTCCTCTGTGCCCGGCACAGCTCATGGGCCCTGGATGGAGGGTCCTGCCATTGCCCCTGG
CCATGCAGGCTCTCCTCAGACTCAGAACCGGGCAGGAGGACAGCGTGCTGGGGAGAGAGC
TTATTCTGTCCCCTCTGCTATTTCTGACCCACCCAGCACGTTCTCCTGAACAGAGGAGCA
CAGGACATCGCCCTGCCCCATCCTATGCAGTCATGCTATCTGGCTTTTGCACGTCTGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved