Pongo_pygmaeus Locus Mono:168:SNORD74
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:168:SNORD74
Pongo_pygmaeus
Mono:168:SNORD74
15
SNORD74
1001..1072
2072
AAATATCAGTAATATTTCTATCACTAATAAGAAACTAGCTGAAAAATAAATCAAGAAAA
CAATCCCATTTACAATAGCTACAAAAAATAACAAAATGCCTAGAAATAAATTTAACCAAG
AGGTGAAAGACCTCTAGAAGGAAAACTACAAAACACTGATGAGAAATTGAAAAGGACACA
AACAAACGGAAAGACACCCATGCTCATGGATTGGAAGAATCGATATTGTTAAAATTAATC
TTGAGACTATACTACTCCAAAGCAATCTACAGATTCAATGCAACCTCCATCAAAACACCA
ATGACATCCTTCACAGAAATAGAGAAAAACCTCCAAAATTCATATGAAACCACAAAACAC
CCAAAATAGCCAAAGCAATCCTAAGCAAAATGAACAAAGCTGGAGGCATTACACTACCTG
CTTTCAAAATATAATACAAAGCTATAGTAACCAAATCAGCATGGTACTATCATAGAAACA
GACATATAGACCAGCACAGCAGAACAGAAAACCCAGAAAGATATTCACCTATTTGTAGCC
AATTGATTTTTGAAAAAAGCACCAATAACATGCTTTGGGGAAAGGACACCCTCTTCAATA
AATGATGATGGGAAAACTGGATATCCATATGCAGAAGAATGAAACTAGACCCCTATCTCT
CACCACATCCAAAAATCAACACAGAATGGATTAAAGGCTTAAATATAAAACCCAAAACTA
TGAAACTACTAGAAGAAAACAATGGAGAAATTCTTCAGAACATTGATCTAGTTAAAGATT
TTATGGCTAAGATCTCAAAAGCACAGGCAACAAAAACACAAACAGACAAATGGGACTACA
TTAAACCAAAAAGCTTCTGCACAGAAAAGGAAACAATCAGCAGAATGAAAAGACAACCTG
CTGAATGAAAAAAAAATATTTGGGGACTAATAACCAGAATATACAAGGAACCCAATTCAA
TAGCAAGAAAACAAATAATTCCATTAAAAAGTAGACAAAGGTTTCTGATGAAGCCTATGT
TGGTAGAGACATCTGAGAGCATTGATGAATGCCAACAGCTTAAATGGGGAAAATGATAAT
AATAAAGTGGGCAAAGGATCTAAATAGACATTTCTCAAAAGAAGACATACAGGTGGCCAA
CAGATATATGAAAAAATGCTCACTATCACGAATCACCAAGAAAACACAAATCAAAACCAC
AATGAGATATCATCTTACTTTAGTTAGAATGGCTGTTATCAAAAAGACAAAAAATAACAG
ATGCTGGCAAGGATGTGGAGACAAGGGAACTTGTATACCCTATTAGTCAGAATGTAAATT
TATACAGCCATTATAGAAAACAATATGGAGGTTTCGGAAAAAAACTAAAAATAGAACTAT
CACACAATCCAGTAATCACACTATTGAATATTTAACCAAAAGAAAGGAAATCAGTATATT
AAAGAGATACCTGCGTCCCATGTTTATTGCAGCACTATTTGCAATAGCCAAGATATGGAA
TCAACCTGAGTGTTAATCAACAGACAAATGGATTTTTAAAATGTGGTCTATATCCACAAT
GGAATACTAGTCCACCATTAAACAAGAATGAAATCCTGTCATTTGCAGCAACATGGATGG
ATCTGAAGGTCATTATGTTAAGTGAAATAAGCGAGACACAGAAAGACAACTACCACTCAC
ATTTTTCTCAGTCACATGTCTGAGCTAAAAAGTTGATCTCATGGGGGCGAAAGTCGAACG
ATAGTTACCAGAGGCTGGGAGTGGGGAAGGGAGAAGAGAAATCGGTTAATGTGGGTACAA
GCACAGTTAGATAGAAGGAATAGGTTCCAGTGTTCAATAGCATAGTGAAGTGATGGTAGT
TAACAACGATATCTATTTCAAAATAACTGGAAGATTTGAAATATTCCCAATGCAAAGAAA
TGATAAATGTCCAAGGTGATGGATATCCTAAACACTCTGATTTTATCATTACACATTGTA
TGAATGTATCAAAATATCACATGTGCTCCATAAACATGTATAATTATTATATATCAATAA
GAAATTTTAAGTGTGTTTCTTATATGCAGCACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved