Pongo_pygmaeus Locus Mono:175:SNORA51
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:175:SNORA51
Pongo_pygmaeus
Mono:175:SNORA51
2b
SNORA51
1001..1132
2132
TGCCTGTAATCCCAGCACTCTGGGAGGCCGAAGTGGGAGGATCACTTGAGGTCAGATGT
TCAAGACCAGCCTGACCAACATGGCAAAACCCTATCTCTACTAAAATACAACAATTAGCT
GGGTGTGGTGGCATGTACCTGTAATCCCAGCTACTCAGGAGGCCTAGTCAGGAGAATCAC
TTGAACCTGGGAGGCAGAGGTTGCAGTGAGCTGATATCACACCATTGTACTCCAGCTTGG
GTGACAGAGCAAGACTCCGTCTCAAAAAAAAAAAAGAAAATTAAAAAAAAAAATCCTAAT
GGCGGTGAGAGAGCCAGTCCTGTAGCGGTAGCTGGGAAAAGAGCAGTCCAGGCGAAAGAA
TAGCTAGTAGCAAAGCCCGGAGAAAGCCCTGAGGCACCACCTCCTGGTGAGAGGCAAAGC
AGAGCTGGGTGTGGGGATCCAGGAGCCTATTATAAGTACTCTGGCTTTTACTGAATGAGC
CAAGAAGTCTTTGGCGAGCTTTAATCTCTGACTTATAGAATAATATCAGTCTTTCTTGTG
TTAGTTGAGCCATTGCTCTTACTTGTATTCTTTCTCCATCGCTTATAATGGAAAAAGCCC
TAGTTTATTATCCTTCTGTCTTGTATTAATTTTATCTGGGATTGAGCTCTAACTGTGGCA
CAGAAACATATTCTCAATAAACTGCTATCTTTTAAATAGTAATAATACTCCCTCAAACAG
TAATAGGCTAATTCCTGTTTTGGGACCAGACCAGTGGTCTTTCAAATCTAATAAGTTTGA
AAAACTATGTACTCAATTCCACATTTTTAAATCGATATTGGAAACTTTTCATCACAAGTT
TAAATATTTGCCAAGGTTGTAATTTCTAACATGTTATAAATAATGACTATTAAATAATAC
TTTTAAATCTATTTAGTAAAAACTAAATATAGCCATTCAAAACCACTGTCATTCATTTAA
AAATACATAAACAAGTTGTTCTTTAAAAGTGGGAAATTTTTGGCTTCCTGGTACTTACCA
CGGTCTGTGTTCTTACATTGACTATATAGAAACAGGAGGCAGAGTAAACCGACCCCACAT
ATACCTCAGCCCATGCCCTGTGCTGGGTCTGTATTGTGAATCAGGAGACATGGAGTTCAG
GAAAAAAAACTGTTGGAAGTTTTTATTTTCTCATTTTAAAAATTTAGTTCTCAGCCTTCT
TTCTTCTTGAGTTCGTACTTCCATTCTACTTCTCTTAGAGAAGGTTGTCCCACTGAAAAT
ACAGGCAATCCTCACTTTGCACAATAATACAGGACCTTCAAAATAACTGTACAAGTTGAA
AATGTATAATGTGATCTAAATAATCAATGGGAAAAATTATGATTGTCCTATGACCTTTAA
AATTTTTTGTCACAACATTATAAACTCTCTTACTATTCGTTAAAACATATAGGGAAATAA
AGAACATGGTAAGACTGATATTTACTTAGTATACTACAATTTAAAACATTAGACACATTG
ATAATTAAAGTGTTGTGTTTCTTTGTAAACACTTAACAATAGTAGTTTGCTTAGTTTCTT
GCCTTCTTGTCATAGAACTTATGATTTGGCATACTCATCTTTCTACGCCTTGATGGACTG
TCATAGTTTTATGTTTGGATCAACTTCCAATGTGTTATCCTTTGCATTTTCGATGTGGTG
AAATATCTCCAAGAGTTCCTTTAATGTGAAGTTTTTTGCCAGGATCACTTCCTTTGAGAC
ATAAGGTGACTCACTCATGTCATGAGTTCACCTGCACTAAGTTCCCTGGCTGCATATCTG
AATTCTCTCCAATGGTGGTAGTGTAAACATTCCCATGGTCAGCTATTTCCTCTATAACCT
CATTACGTTCATTTCACGTTTTTTTTTAATTGATTTTTTTAGACGGAGTTTTGCTCTTGT
CACCCAGGCCGAAGTGCAATGGCACAATCTTGGCTCACTGCAACCTCCACCTCCCAGGTT
CAAGTGATTCTCCTACCTCAGTCTCCGAGTAGCTGGGATTACAGGCACCCACCACTACGC
CTGGCTGGTTTTTGTATTTTTAGTAGACACAGGGTTTCACCATGTTGGCCAGACTGGTCT
CGAACTCCTGACCTCAGGTGATCCGCCTACCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved