Pongo_pygmaeus Locus Mono:32:SNORA58
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:32:SNORA58
Pongo_pygmaeus
Mono:32:SNORA58
1
SNORA58
1001..1138
2138
TGTGTGAACAATTCCTCATTTATGTTCTCAGCCAATAATGTTCCTCTGCTATTTCTTTT
AAAACCAATGGTTTATCTGACATCTTCACTTGGAGATCTCATGGTTACCTAAAACTCAAC
ATATTCCAATTTGAATTCTTCAGTCTTCTCCTCCTTCACCCAAGTCTGTTTCTCTCAGTC
TTTCTCATCTCGCTATATATCACAACCAACCATCCAGTTGCTCAAAATAGAAACTTGCTT
TCATCCTTGATTTAACTTCCACTATCATCCCAGACTCCAATCTATCACTAAGCCCTGTAG
TTTCTCTTTTCAAATATACCCAAAATCTGCCCACTTTTCTCCATCTTGATGGACTTAGAG
TAAGCTATTGAAAACTCCTACTTAGATTACTAAAATAATTTCTTTGTGACTCTTGTAGTT
TTCCCTATCATCTTCCTAAATACAACATCTCACGCAGTAGATAAACTAATAAAAATATAA
CTTGTATTCACATTTTCCAAATAATTTACCGAGCTCTTTTCTACTTGCAAACCCTGCATG
ATGAGGTTTCTACCCAACTCTCCATCCTTATTTGAGGTAACTCTCTACATTATTCAATCT
TCTTTACCATCTTTGTTCCTTTTTGCTTCTTTGAACACATAAAGTTCTTTCCTATATCAA
GGACTGTAATACCCTCTGCCTGAAATCGTTTTCCCTACTCTTCATGCATGGTTAGCTCCC
TAGACACCTTCAGATGTCTGTTTAAATATCCCTTACATGTAAAACACAATTTTCCACCTT
ACCCACCTAAGTTCCCATGTTTCTTTCAAGGTCCTTACCAGGGTTGTTCCATGGCTTCTT
TATGTCTTTCACAGCTCTTATTACAATATATATATGTATATTTCCTTTTATACTTGCTTG
TTTACTATCAGTCTTCTCTCCAAACCAAAACCCTCACAAGATAAGATGCATACCTCTTTG
GCTTATCAGTATATCATAGCTACCTTCAAAAGACCAAAACAGGGCATACCTATAGACCTT
GCCTGACTGTGCTCATGGCCAGGCAGCGGGGGGACATTGTATGTGAGATTAATTTGAAGT
TCCTACCAGCTTTAGCCAGCTTAATCAGTGGCCAGATAAATAGCAGGACTGTAACATTCC
CCTGGGGGAAAAAAGGCAAGAAGAAAAGGGGAGCATAGGGATTTAGATAAGAAAGTGATA
TAGGCCGGGCACAGTGGTCCATGCCTGTTATCCCAGCACTTTGGGAGGCCGAGATGGGCG
GATCACCTCAGGTTAGGAGTTTCAGATCAGCCTGGCCAACATGGTGAAACCCTGTCTCTA
CCAAAAATACAAAAATTAGCTGGGCGTGGTGGTGCGCACCTGAAATCCCAGCTACTCAGG
AGGCTGAGGCATGAGAATCACTTGCACCCAGGAGGCGGAGTTTGCAGTGAGCTGAGATCG
TGCCACTGTACTCCAGCCTGGGCAACAGAGCAAGACTCTGTCTCGAAGAAAAAAAAAAGA
GAGAGATAGATGACTGATTAAAAATTATGAGAATGGGCTGGGTGCAGTGGTTCACAGCTG
TAATCCCAGCACTTTGGGAGTCCAAGGCAGGTGGATCATCCAAAGTCAGGACTTTGAGAC
CAGCCTGGCCAAAATGGTGAAACCCCTTCCCTACTAAAAATACAAAAATTAGCTGGGCAT
GGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved