Pan_troglodytes Locus NOL5A
snOPY snoRNA Orthological Gene Database
Pan_troglodytes NOL5A
Pan_troglodytes
NOL5A
20
SNORD110, SNORA51, SNORD86, SNORD56, SNORD57
2683..2757, 3538..3669, 4570..4655, 5105..5175, 5420..5491
7810
TTTTTAGGTTTGACATATTAGATTTGTGAGTGAACTATGTACTTGGATTTTGTCAAGTA
ACTCAATCGCTTAACAAAATAACAATTAAATGTATAAATGCAGTTTATAGCTATACAGCA
TTTTAAAAAATCCCCTTCGAATGACTCTTTAAAATATACCAGGGGATACGCTACTTAAGT
ATAACTAGGTTTTGGATTTATAACGTTAATATTAATTATTAAAGCAAAACTCACTTCTAA
AGACTCGCCTGAGTGCCCAAAAGACGCCCTCAAGGACAGGGAAGCAGCTGCGATTCACTC
AGCGATCACCAGCGCCCAGAATTCAGGGCCGCTCAAGCGGAGCAGCAACACGTGGCCCAG
CGAAAGGAGCTGCGTCCCGTGCAGCACAGCAACAAGAAACTGGCCTAGGAAGACGCTGGA
GCGTCTTTCTTTCGCACGTTACTGCCTGCTACAGTCATTAAAAAAAAAACCAAAAACAAA
AAAAAGAAAGAAATTAGTAGTACGAAGAAAACTGCGCGAGCTACATTCCCAGCAGGGTCT
GCGCCAGAGCGCGCCGGGCACCGCTCCCGTTACGGGTGGGAGGAAAGGATGCACCGCCCA
CCCGGCGCCGGGGAGGCTCGTCCCCGAGTAGGGGACGGGAACGCCTGGGTCCCGGGGACG
TGGGGCGCAGGGTCTGGGGCCCGAGGCCACGGACGAAGCGGGAAGCCGGCTAGGCAGCGG
TCTCTGTCTGGGATGGACGCCGCGCCCCACGCGGACCTCCCGCCCCGACTTCACCCAGCT
CTGCTGCCCGTAACTCATATGACAAGAACATCAGGAACCGGACTATTACCCCGAAAGGGC
CTTCCCAAGTCGTTTCGCCGCCTGCAATGCCCGATCGGGGGCCGCGCGTCCCCGGCAACC
ACGCCCGCCCGCGCAGCTGCAGAGGCCAGAAAAGGCCTGCTCGCCCGCGCTCCGCGCCAC
CCAGCCCGCGCTCCGGGCGATACCACCCTGGGCGGCCCCTCCAAAGGCCGGAGATGGTGT
CGTCCCCGGCCTCCGATTGGTCGGGGGGGCGGGGGCGTGGCCTCTGGAGCCTGGTTCCGC
GCGCCGGAGCGCGCTAGCCGCATTGCGAGCCGAACCCGGGAGCTGGCGCCATGGTGAGGA
GTGGTTGCGGGGCGCGGGCGACGCGACGGTGGGGGTTTCGGCCTGCGTTCGGGCCGCAGA
CAGCCTGGGCCTGGGCCTGGGCCTGGGCCTGCGCCTGCGCCTGCCCTGGGAACGGGTTCC
GGCAGACGCTGAGGTTGCGTTGACGCTCGCGCCCCGGCTCCCGTTCCAGGTGCTGTTGCA
CGTGCTGTTTGAGCACGCGGTCGGCTACGCGCTGCTGGCGCTGAAGGAAGTGGAGGAGAT
CAGTCTGCTGCAGCCGCAGGTGGGTGAGATCCGTGGGCTCCTTTGGCGGCCCCGCAGACC
CTCGTCGCGCGGGTCCCAGCATGCACAGCGCGCTCCCACGTGGCCGGCCGAGCGGTTCGG
GGCGGGGGGGCGGACCTGGAAAGCTCTAGATCCGGGGGTCTTTACCTTGACCCATGGGTA
GAATCGCTCTAGCAATTAGAAATAAGCCTCCCGGATGCCGCCCCCGTACGATTAAAGCAG
AAGCTGGGATGTGGGGCCCAGGTATCAGCATATTTTAAGAGCTTCCAAGGCTGGGAACCG
CTGCTTTACTGCGCCGCAGAAGCAGGAGGGAGGGAAGGAAACCACTTAGCCTCTTTCTCC
CCCCAGGTGGAGGAGTCCGTGCTCAACCTGGGCAAATTCCACAACATCGTTCGTCTGGTG
GCCTTTTGTCCCTTTGCCTCATCCCAGGTTGCCTTGGAAAATGCCAACGCCGTGTCTGAA
GGTAAGTCGGCCACCGCCAAGTATCACAGAGAGATGTGGTCCCTTTCGGAATCCTCTCGG
GCAGCCTGTGATAGTATTTGCCGTCCTTGGCTGGCTCTGAGTCTGATAGGCGTGAGGCAG
TATTTGAGACATACAATGTGTAATTTGAAATAATTGTCTTCACAGAGCTCAAGGTCTGGG
AACTGCGCTAGACCAAACTGTTTAAGCAGACGATGTGGGATGTGTGTTAACGTTTCCTTG
TGGGCACTGTAGTGACAAACTATTTTTTATTTTTTTTTTTTTTTTTGAGATGGAGTCTGT
CCCCCAGGCTGGAGTGCAGTGGCAAGATCTGGGCTCACCGCAACCTCTGCCTCCCTGGTT
CAGGCGATTCTCCTGCCTCAGCCTCCCGAGTAACTGGGATTACAAGCCTGTGCCAGCCAC
CACACCCGGCTAATTTTGTATTTTTGGTAGAGACGGGGTTTCACCATGTTGGCCAGGCTA
GTCTCCATCTCCTGACCTCGTGATCCGCCCGCCTCGGCCTCCCAAGGTGCTGAGATTACA
GGCGCGAGCGACGGTGCCCGGCCGACAAAGGGGGGTTTCTTAAAAGGGGGTCGGCTTGAC
ACCTACTTGTGCCCGAGGTTTTGCCTAAACACAATCAAGTGTCTGGTTCTCTGCTTTCTG
TTCGATTGGAAAGGGCAGTTGGGTAAACACAGGCTGAGAAAAAAAGGTTTGGTTCCAGAA
GGCAAATTCTACGAAATACTCGAGGGTGTGTTACAAGCTATTATTTATTGCCCACTTGTG
CTACCAGACCTGAATGCAGTTGTTCCCATGGCTGGGCCAGGCTTTGCAGTGATGACTTGC
GAATCAAATCTGTCAATCCCCTGAGTGCAATCACTGATGTCTCCATGTCTCTGAGCAATG
CCTGATGGGGAGGGATCTAGGCATGCCATCCCAGCGTGCTCGGTGGGACCAGGGTAGTCA
GCTGAGGGATGTTAGAGTTGATTGTCCTTCAGCCTGTTAGTGGGAACTGTGTTCTTTCCC
CTGAGGGGTTGTTCATGAGGACCTCCGCCTGCTCTTGGAGACCCACCTGCCGTCCAAAAA
GAAGAAAGTACTCTTGGGAGTTGGGGATCCCAAGATTGGTGCTGCAATACAGGAGGAGTT
AGGGTACAACTGCCAGACTGGAGGAGTCATAGCTGAGATCCTGCGAGGTGAGACCATCAT
CTGTTATATTCCTGTTATCCTGGACATTTTGGGGGAGGAGGTTCTGGAAACTTGGTTGCT
TGTTGTGATTTCTGGGAAGGCCTTCGGGCTTGGCTGGTGCCCATGGGTGCGGGAGCTAGC
TCAGAGCCCCTTGTTGCTCACCGTCTTGCCCTCTTCTTAGGAGTTCGTCTGCACTTCCAC
AATCTGGTGAAGGGTCTGACCGATCTGTCAGCTTGTAAAGCACAGCTGGGGCTGGGACAC
AGCTATTCCCGTGCCAAAGTTAAGTTTAATGTGAACCGGGTGGACAATATGATCATCCAG
TCCATTAGCCTCCTGGACCAGCTGGATAAGGACATCAATACCTTCTCTATGCGTGTCAGG
TAAAGTGCAGGGGCCACCCATAATACTGGAGCCTTTGGTCTGTAGTTCAGTTAATTTTGA
GTCTTGATGAGGACTGACCATCCTGTGGGTAGAACCATGTGGGCTGGGGCTGGGTGTAGG
CCTCCTGGTGCTTACCACAGGCTGTGTTCTTACACTGACTGTATAGAAAGAGGAGGTAGA
GTAAACCTACCCCATATACACCTCAGCTCAGGCCCTGTGCCTGGTCTGTATTGTGAATGG
GGGAACATAGAATTGAGGAAGATTTGGGTCTTTGTCCCATTTCCTCCAGGCAGAGTAGGT
GTGGAGAGGGCAAGGCTGTAGCTCTATGGTTTTTGATGAAGCAGCTGGGCCAGGGAGTGA
CTGTGGCTCTTTGCAGGGAGTGGTACGGGTATCACTTTCCGGAGCTGGTGAAGATCATCA
ACGACAATGCCACATACTGCCGTCTTGCCCAGTTTATTGGAAACCGAAGGGAACTGAATG
AGGACAAGCTGGAGAAGCTGGAGGAGCTGACAATGGATGGGGCCAAGGCTAAGGCTATTC
TGGATGCCTCACGGTCCTCCATGGGTCAGTGCAGAGCCTGGCAACCTGCATAAGGTATGG
GGCTCTAAATATCTGGCCTCTTGCATTCACACTTGGTTTTTCCTAGGCATGGACATATCT
GCCATTGACTTGATAAACATCGAGAGCTTCTCCAGTCGTGTGGTGTCTTTATCTGAATAC
CGCCAGAGCCTACACACCTACCTGCGCTCCAAGATGAGCCAAGTAGCCCCCAGCCTGTCA
GCCCTAATTGGGGAAGCGGTGCGTCACAGGGGACTCAAAAATGGGAGAATAAGGACTGTT
GGCCATGTGCACCTACACTGCTGTATTTCGTGACCCACCATGTCTTCCCTAGTTGTGCTT
GATGCGGGGAGGTGGGGAGCAGGGCTGTCGTGCAACTGGCAGGTCAGCAGTTCATTTCTC
TGACTGCTTCCTTGACTCTCTCTCCAGGTAGGTGCACGTCTCATCGCACATGCTGGCAGC
CTCACCAACCTGGCCAAGTATCCAGCATCCACAGTGCAGATCCTTGGGGCTGAAAAGGCC
CTGTTCAGGTACCAGTGAGGGCACCTGCCCACAATCAGGTGCCACTTCTGGTGCCCACTG
CTTGTTGGGGGATCACGGTGATGGCTGACCAGGGCTCCCTGACCTATACAGGCCTCTGCT
ATGGGGGTGATGGCCAGTCCTGGTGTCTGAGTGATTCCCAGGGCCCAGCAAAGGGACCAA
GTCTCCAGGTCAGCGACATTGGATGCCTTCCCTCTGCCTCTGGGGGCTATGGGTTGGCAT
GCATTGGGGTAGAGATCCAATCTGGCCTGAGGCTCACTCAGGACTTCGGGGTGAGAGGAG
GGGAGGAGCTGAGCTGCCTTGGCTAATGGGGTTGAAATTTCTGATCTTAAACTCTCCACT
GAATATTCTCTCAGAGCCCTGAAGACAAGGGGTAACACTCCAAAATATGGACTCATTTTC
CACTCCACCTTCATTGGCCGAGCAGCCGCCAAGAACAAAGGCCGCATCTCCCGATACCTG
GCAAACAAATGCAGTATTGCCTCACGAATCGATTGTTTCTCTGGTATGGGTGGGGGGGCG
TTGGCAGGTGTGAGAAGGGGCTGGGTGGCTGGGTGGATGGGTGGGGAGGCTTGCAACCAT
AGCTTCCACAATGATGGCAATATTTTTCGTCAACAGCAGTTCACCTAGTGAGTGTTGAGA
CTCTGGGTCTGAGTGAAGCTGAGGGTAGAGGGAACACAGGGTTGGGGTAGTTTCTCTCTT
TGGGCTGACAGGCTTTGTCACCCACACACATCCAGAGGTGCCCACGAGTGTATTCGGGGA
GAAGCTTCGAGAACAAGTTGAAGAGCGACTGTCCTTCTATGAGACTGGAGAGATACCACG
AAAGAATCTGGATGTCATGAAGGAAGCAATGGTTCAGGTCAGTTGGGCTTTGCTGGGTGT
GGAGTGGCATAGCTAGCTGTTGGAGGTGATGAACTGTCTGAGCCTGACCTTGTAGAATGG
AGGCAAAAAAACTGATTTAATGAGCCTGATCCAATAAAGCCAGAAAGGAGTCCTCAGAGC
ACCAGAAGTCTTCAGGCCCTTTTAGCACTTTTCTTTGACCAGGCAGAGGAAGCGGCTGCT
GAGATTACTAGGAAGCTGGAGAAACAGGAGAAGAAACGCTTAAAGAAGGAAAAGAAACGG
CTGGCTGCACTTGCCCTCGCGTCTTCAGAAAACAGCAGTAGTACTCCAGAGGAGTGTGAG
GTCAGTAGGCAGCACGGCCCTGGCAGAGATCCTAGGTTGTAGGATTTTCAACACCAGAAC
AAAGGATGTGCCGCATCAAGCTGTGGTCTTGAGTCCAGGCTTTTGGACTGAAACAAGGAC
CTGAAACATCTAAAACTACCTCTTGATTCTATAGGAAGGAGATAGGTGCTGAACTTGCTC
AAGAGCCCAGAGAGCTGGTTGTAGCTCACACTCGTTCCCTGGGCATGTGTGTTCTGTCCT
CGGCTGCCTCCCAGGAGTCCTCAACCTGGGGTAGTGTAAATTCCTGCTCTGCTTATTATC
AGACGTGTGTCCGGAGGTGGTAGTGTTTCACAGTGGGGATGGGGGCAGGGAGGTCCCCAG
TGTGCTAAGCTACAATCATTCTCCCTGAGATTTTCATTTAGCACCCAGTTTCTTAAACAG
TGTTTCAGGGCCCTGTCTGGAACTTGGCATGATGGTTCTGTTGCGACCAGCATGGTGGGT
GTTTCTTTAGGTTTTTTTTTAATGGGCTGAGGTAATTGCTCATTACATGTTTTCCTTCTA
ATTTGGGACAGCCTTTGGGGTGGATTTCTAAAGTTATACCCACACAATTAAACTATCCCA
GAAACACTGGGCAATGTTAATGACACACGTTCCCCTGCCTTGGCTACTTAATTGCTGAAG
ATGTAATGAGCACTGTTCTCACAGCCTGTTCCCCTGTCCTTCCCTTTAGGAGACGAGTGA
AAAACCCAAAAAGAAGAAAAAGCAAAAGCCCCAGGAGGTTCCTCAGGAGAATGGAATGGA
AGACCCACCTATCTCTTTCTCCAAACCCAAGAAAAAGAAATCTTTCTCCAAGGAGGAGTT
GATGAGTAGCGATCTTGAAGAGACCGCTGGCAGCACCAGTATTCCCAAGAGGAAGAGGTC
TACACCCGAGGAGGAAACAGTTAATGACCCTGAAGAGGCAGGCCACAGAAGTGGCTCCAA
GAAAAAGAGGAAATTCTCCAAAGAGGAGCCGGTCAGCAGTGGGCCTGAAGAGGCGGCTGG
CAAGAGCACCTCCAAGAAGAAGAAAAAGTTCCATAAAGCATCCCAGGAAGATTAGAATGC
AAATGGACATTCTCTGGGAGGTGGGGCATACCATAGCCCAAGGTGACATTTCCCACCCTG
TGCCGTGTTCCCCAATAAAAATAAATTCACAAGAGTTGGTTCATGTTCTTTATTGAACAC
CTTACATGGGTATGGACAGGGCCTATGGGTGGGGCAAGGCAGCAATGACAGCCTCAGTGA
AGTCATGGCAAGTAGCATAGCCACCCATGTCAGAGGTTCGAACCTGTGGGGGAGAATCAT
CATCATCCATGTGGCCTGGGCTCCATCCTAACAATCCCCATCACCACCCAACAGTCTGTC
CCCTAAGGAAGCTGGCCCAAGGACAACCTAGGCTCTACCCAGCAAGGTGACCATGGTCCA
CTGCTTAGAGGCACAAGGTCTCTTCCCTGGTACACTGCACTGAAGGGTATGGGGAGTGTG
GTCCTTGCAAGGTTGGAAGAAATAAAGGGCTCTAGCTCCCTTTAGTCTGCAGGTGACCGA
TGACAGACTTGATGAAGTCGGTTGTGGTGCTGTAGCCGCCCATGTCTCGAGTCCGCACCT
ACAGCCACCACCGGCAACAGCCGTGGGGAGGGAGAAAAGAGAGCCCATGAAGGGAGGTAG
GGCAATGTGATTGAGGAAATGGAATCCAAGAATGCGTGACAGCCAGAAAAAAGGCAATGC
ACAGGAATGGAAGGAGGAGCCAGGATGGGAAGCACATGGACCTGCCACTCCTCTTAAGCC
ACTATTAGCTGTGCTGCAGCCAGGGCAGGACAGGAGGCTGAGCAGGCAAAGATGATGGGA
AACGCAGATCAGAGGCAGGATGTGGCTACCGAGCAGGCAAAGATGATGGGAAATGCAGAT
CAGAGGCAGGATGTGGCTACCTTCCTTGGAAGAAATAGACAAGACCAGGTGGAAGGAAAG
AATCACAGCGAAAAGGAGATGGCGTGAAGGTGAAGCTGATGCTTCAGCCTGCCTGTATCC
CTTGCTGTTCCACCCCCAAGGAGAGCTGCAAGTTCTGCATTCAGATGGCCCATGAAAAGG
GCAGTGGATGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1132, 1309..1398, 1746..1860, 2885..3046, 3220..3418, 3796..3983, 4066..4217, 4407..4507, 4874..5022, 5255..5376, 5562..5699, 6409..6810
1130..1132, 1309..1398, 1746..1860, 2885..3046, 3220..3418, 3796..3983, 4066..4217, 4407..4507, 4874..5022, 5255..5376, 5562..5699, 6409..6771
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved