Pan_troglodytes Locus mono:SNORA57
snOPY snoRNA Orthological Gene Database
Pan_troglodytes mono:SNORA57
Pan_troglodytes
mono:SNORA57
5
SNORA57
1001..1145
2145
AGACTCCATCTCAAAAAAAAAAAATTCATAGGGTTGATATTGACAATATCAGTTTTGTC
AGTTGATTTGTGAGATTTATATCTCAGGACTTAACTTGAGGAAATACAGTATAGAGCAAA
AGGAATACCCAGCTAATAATGGGCAAGTTTCTCAAAGCTTTTAGGAGCATAGTTTGCAAG
AATATAGTATTTCTTTCTCTTTCTGAACATTGTACTTAAGCTAAAAATAAAGCTTAGAAT
TTTGTAATGATCGTAGTCATAGATAAAATTTAAAAATAGTAAATGGCCAGGCACGGTGGC
TCACACCTGTAATCCCAGCACTTTGGGATCCTGAGGCAGGAGGGTCACTTGAGCCCAGGA
GTTTGAGTCTGCACTGAGCTATGGTGGTGCCACTGCACTCCAGCCTAGGTGATGGAATGA
GACCTTATCTCAAAAAACAAAACAAAAGATTAAGTGACATCTAAGATACTTCTGTCTTTA
CCCATGAATCTAACCCCAAGAGAATACAGTTTCTAGTTGTTTTTTTTCTGTTTGCATCAA
AATATCTTTTTCTTTATAACTGGATAGAATTTAACATGTTAGTCCCAGTTCTGTTTTATT
GATTTCGTAGCAAAATCTTGCACAAGCCAAAATACCAATATGTTTTATGGTTCTATTGAA
CCTACTTTTTGATTCTTGTCCATTCTTGAAAGCAAGAGGGCTTTGACTGCAAAAACCCAT
TAAAGGAGAAGGACTTGACAAATGAGTACAACCTCAAGTGAAGTATGTTTATACACATTT
TTGCCAGGCTCTTAACATTAGAATTTCTCAAGCCGAGGAAACTTCAGATAGAAGAGGGAG
ACCACCTTGAAGAAAGAGTCCTTTGTACTCCTAGTGTATTTCTTAGGAAACAATTAGCCC
TTCCCTTGATCGTGGTCTCAGGACAGGCAGCAATATGCTTTTGATAATTGATGTATGCTG
CCTAGGAATTATTTTGTTTGGTCACTAAAGGTCAATGCCACCCTCGCTTTCTTTGCAGGG
AGCAGGTATGTATGTTCCCTATTATGTCTGGAGGCAGAGGGAAAGGGCTTCAGTCCCCTG
GGCATCATGTCTTTGGTGCCGGTGGCTTCCTGTCTGCCAATTCTATCCTCAAGCACTGGG
ACACAGAGGGGGAAAAAAAAGGCCAACTTCTGTGCCATCCTAAGTATGGGTTCACATCTT
TGAAATCTTATGGAGGCTTAAAACCTCTCAAATGGGTTGATAATACAGTTTCACTTTGGG
AGGGTAGGTGAAAATCCAAATCCATGTTAAACATTTATTCAAGTAACTCCTAAAGCCAGG
AGGCAGAATAGTCCTGGTTAAGAGCATGAACTTTGGAGTCAGTGTTGGTTTGAATCCCTG
TTACACTGTTTAGTTCTATGATCTTTGAGAAATAGTTACTTCTTCTAATTCAGTGTACAT
TTATGTGTTTTCTTTGTGACAGGCACTGTTCTAATTGTTTGAGAAATATTACCTCATTAA
ATCTTTATAACAGTCCTATGAAACAGATATTATTGTCATCTCCCTCATCTTCCTTTCCAT
CCTACCCAGGTAATCGACATCTTTATTTGCAAAGTCAATTATACCCTATACTTCAGGAAC
CATCTGTATTCTGAATTTTACTTTCACCAGTTTTATACTTTGAGATGTTTTGTGTTTCTC
ATTGACATCCTTTCTTTCAGCTTCAAGAATTACCTTTAGCATTTCTTGTAAGACAGGTCT
GGTAATGAAGGACTCACTCAGCTTTTGTATAGGAAACTCTTTTATCTTTCCTTCATTCTG
AAGAACAGCTTTGCTGGTTATGGTATTCTTGGTTGCCATTTTTTTTTTTTCATTGCACTT
TGAACATACCCACTGTCTCTGGGTGTGAAGGTTTCTGCTGAGAAATCTGCTGCTAGCCAT
ATTGGAAGTCCCTTATATGTTATTTGCTGCTTTTCTCATGCTGCTTTCAGGATCTTCTCT
TTATCTGTTTTTTTGTTTGTTTGTTTTTGTTTTTTTTTGGACAGTTTGATTATAATGTCT
TGGGGCAGTGTTGTTTGGATTGAATATGATTGGACACTGTAGATTTTTCTGTATGTGGAA
CTGTTTGATTATATTTCTGACAGGAACCCATCTTATCTTTAAATAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1081, 51358..51594, 73619..74415
1012..1081, 51358..51594, 73619..74013
NC_006472
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved