Pan_troglodytes Locus mono:SNORA51
snOPY snoRNA Orthological Gene Database
Pan_troglodytes mono:SNORA51
Pan_troglodytes
mono:SNORA51
5
SNORA51, SNORA51
1001..1133, 1001..1133
2133
GAATTTCTCATATATGAAATCACATAGTATGTACACTTTTGTGTTTGGCTTTTTTCACT
CAATGTAGTATTTTTGAGATTTATGCATGTCGTTGCTTGTAGCATTAATTTGTTCTTTGT
TGTTACTGAGAATAATCCTATTATATAAACATACCACAAATTGTTTATCCATTTTCCCAC
TGACAGATGGTTGAGTTGTTTCTGGTTTGGGACTATTGCGAATAACAGTACTATAGGCAT
TCTTGTACAAGTCTTTTTATGACAGTGTTTTCATTGCTTTGGGAATGGAATTTCTAGGTC
AGGGTGTAGGTGTACAGTTAACTTACAAAGGCACAGACAAATAGATTTCCTACATTGTTA
TAGCTTATTTTCACTTCCATCAGCAACGTATTAGAGTTTCATTGTTCTATATTCCTCAGA
ATTTGGTAATGTCAGTTTTTTTAATGTTAGCAATTCTAGTTAGTATGAAATAGAAGTTCA
TTATGCTTTTAATGTGAATTTTTCCAAAGACTAATGATTTTGATCATATTGGCTTTGTTG
ATCTTTCTCAGATTTTGTTCTGTATATCACCAATATCTGCTCTTAAAACTTCACTTCTAC
TTTTTTGGGGTCTACTTTGCTGTTATTTTTTCCATTTGTAATGTTGGTTAATTAATTTTT
AGCTTTCCCTTGCTGTTAGATGAATGTTTATGTAACATTTCCTCTGAAGTGCCATTTTCT
TGCACATCATAAGTTTTTATATGTAGTATTTTACTATCATTTAATTCTAAATATTTTTCA
AATTTCATTGTTATTTCTTTTTTTGAGCCGTAGTTGACCTAGAATTAGTGTTTTTTATTT
CCCAATATATGTAGAGTTAATTTATCCTTTTGTTATAATTTTTTAACTCAATTGTGTTTT
GATGTCAGGGAATATAATCTACTCATGTAGATTACCTACATTTTGCAATTCGTTAAGACA
TACTTTCTAAGCTAGCATGTGATCAAGTTTTAGAAATTGTTGGCCTCCTGGTGCTTACAA
CTAGCTGTGTGCTTGCATTGACTGTACAGAAAAAAGAGATAGAGTAAACACACCCCATAT
ACAACTCAGCCCAGGTCCTGTGCCTTGTCTATATTGTGAATAGGGGGGACATAGAAAAAA
ACAAGAGAGAGATAAATTGTTCTTGTGTGTTTGGGAAAAATGTATATTCTCTAATAAATA
AATATAGAATTCTCTATATGTCCATTTGGTCAAGCATAGTAATTATATTGCTTCTATAAC
TTTGCTAAATTTTTGTTGTTTGTTGTTGCATACTTATCAGTAGTTAAAAAGAATAACTCG
AACTCCTGTTTACTAATTTATTCTCACAGAGCTGCACTTACAAACCTCTTTCTCTAACAT
GTTTAAAATAGCTTTTCATTTCTCCAGGGGCTTAGCTCAAGTGTTTTTTTTTTTCTTTTA
ATCTATAATATCTTGGATTTCACGTTTCCTTCTTTAGTCCTTCAAAGTTGCTTTTAGAGA
CAGGAGCCAAAAGCCATCTTTACTGGCACTAAAACTCATGTCACTAACTTTTCTGTATTA
ATTGTTTATCCAGAAATCTCTTCTTAATTGGATATAATCTATTTTTTGTATATACAGATT
CTTCAGAGATTTTACTGTAAATATTTAAAAAATAAATATGGTCCCTCTTCTTTTCACATA
TTTATATTCTTTATTCTTTTTCTTTTTAAGGTTATTCTTGACTGCAACTGACTATTACAT
TTTGAGTAGTAGTAATGATATAGACACCCTTTTGTGGTTTCTGGCTTTTAAGATAAAGCT
TCCAATGATTTATGGTTAATTATCATGTTTGTTTTAGTTTTTCCTAGATACATTTAATTA
AAATAAGGAGAACTATTCTTAGCTTGGAAAGTTTTTTTATTTGTTTTTAGAATTATGAAT
GGAAACTGAATTTAATGGAATTATTCTTTGGCATATATCAAAATATTTCCTACTATTTTG
CTTTAAGTACATCAATACACCAATGTTATGGTCTGTAAAAATAGATTTTACAGTATTTAA
TCATCCTTGCTCTTCTGAGACTAAACCCATCTCCGTTATAATGGATTCTTTTTTATTGAT
ATCCCTAGGTATGGTTTTCTTATGTTTTGTTTAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1045, 86791..86902, 88277..88382, 90910..91067, 101724..101823, 104172..104338, 111359..111492, 123703..123826, 124632..124881, 162497..162675, 163172..163183
90921..91067, 101724..101823, 104172..104338, 111359..111492, 123703..123826, 124632..124881, 162497..162675, 163172..163183
NC_006472
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved