Pan_troglodytes Locus RPL37
snOPY snoRNA Orthological Gene Database
Pan_troglodytes RPL37
Pan_troglodytes
RPL37
5
SNORD72
3478..3557
4761
ttttgagacagagtctcactcagtcatccaagctggagtgcaatggcgcaatctcggct
cactgcaacctccaccttccgggttcaagcctccctccacctccaccccctgagtagccg
ggttggcaggcgcgcgccaccacgcctggataattttttgtattttttttgtagcgacag
tgtctccctatgttgcccaggctggtctccaacgcctgggctcaagagatccgcccgcct
cagcctcccaaagtgctgggattacaggcgtaagccacggcgccaggcccttggaaacta
tattgaacaagttccatgtgtgattccttggcacaatgaaatatgggatcagataacttg
cctctgatttactaccgtaacaacaacaacaaaatcactgtctgcctttccctttatatt
ctaagctccagctccatgcctccgtactcctagcgacctctcgcagggaaagtcagcgtc
ggccaaaagcctccgggatcggaatgaggaggctgctggagaagttgctttctcctaata
gggattatcccaggcgcacacggtcattacacgccggggacgctcagtcggtgcgggtac
ccctgggcagggccagccccgcattccaggttctccatgtgcctagaagacagtaatcga
cggtatagcaacaaatctgactgctaacgtgcgaaaccgatcagtagtagcagtagcacc
agcaacagcagcacgaaatgcaaaactgtaatctaaacggccctcagggtctaagcaggc
ccgacgaagacccgcccatccggtcgccagaaaactgggagtcccgcccgcctttccggc
actgaaacgcgatcagccctgcctggtaccgcatcctcctcttgaccccaccgacactac
gacgacggacgcttgagaacgctgcaccgcgccccgcaggaagtgcttccctgggcggaa
gcttctgagcgtgatatagcggaagtgccttctcttccggtCTTTCTGGTCTCGGCCGCA
GAAGCGAGATGgtgagttgtgactgtggtgtttgtgaatcgcgttccatcctcgtccttt
gtgcctctctgtttgctgtgcttgggggggctggcaagattccggataaggggaactggt
gggctggaaagaggcatgcggtggccctcaagagccagaagaatgactgctaactggtgc
ctgggggacctatcccgccgtaattgtggtactagagccgcattgtgtcctttgcctcgg
tccaacctttggagacctttcacggctctagccttggttgggagccgagggaaggagttt
gggaatgtttggctctgtgtaacaatgaaataattcattggtgatgctctctgtccggag
tctataaagataaggtgcatttcagaacattgcaactcttgcggagggctttaggtaacg
tgaaatgcgggtagtggtctctgacttggcattcgtggaaagaggcttctcccacagttg
cgatctttatgattgcctttaaattttatcagtaattggtttctcggagaactcgagtaa
atctagaagttgccaggtttcagaactatttattcctttaatgtgcagACGAAGGGAACG
TCATCGTTTGGAAAGCGTCGCAATAAGACGCACACGTTGTGCCGCCGCTGTGGCTCTAAG
GCCTACCACCTTCAGAAGTCGACCTGTGGCAAATGTGGCTACCCTGCCAAGCGCAAGAGA
AAGTgtaagtaacatttttcaggccaactgtgttagcttttgtttgtattgcacttaagt
gggggcataggtgtgaactttatttggtgcctatcttaaaactcgtacatctgtatgccg
atgaggtggcataaaactcgtgtgttaacaacacctacaaggtgtgtgggagaacaccgt
ttgaaatcttttcggaacttatgttttagATAACTGGAGTGCCAAGGCTAAAAGACGAAA
TACCACCGGAACTGGTCGAATGAGGCACCTAAAAATTGTATACCGCAGATTCAGgtacag
tttgtatgttcgatcataattggtccaatgggcttgaatgaaaccctcgtgtttacttgt
aaaaagataacagtaccctgatggttactggggatgagatgttggaagctttttatttgt
tgtttttgaggcagggtttcactatgttgcccaagcttgagtgtagtggcacgatcacgg
ctcactgcagcctcagtctccccagcctcaggtaatctcatctcagccgcccgagtaccc
gggactacaggtgtgcgccgccacatgcccagctaatttttgtatttattgtagagaatg
ggatattgtcatgttacccaggataatctcggaactcctgggctcaggccagatgttgaa
agcctttatcttctgccgctgtaaccttgacatcagttagtttggattttattagtagtt
tttccactaaacagtagtataaattaaataacaggagcattgtttgaactagggtcccaa
agtgttgatatttattaggtttacttggtgtcaaaatttgtcaagacagtagtgaataag
gtctggagtcaggcttggttcaacctttagtatagtggctgtgggcaagagtgctgtaga
aaattgccctggttgctgctgttgccttgggctcttgttactcaagtcttggccttagag
ttataaatgcagaatctcagctccgctgtagacttagctgagagaacctgcatattaaag
agtagtttctaagagattaacccatctaagatctcagctaagattcagaatgatgcagac
ttaactttaaagctggtgctccttccgttactatgttctatttcagcaattctcagctgt
tgatattttgggctggataattctttgtggtgggattgtccagtgcaaaattgaatattt
tgcagaatccctagcctctacccactcagtctccggagtgtccagttttaaagatagcaa
gacagttcagggctttgtagacacccataggtgtgttcatgtgctgaagcaactttcttt
gcatttagggtcataacgtttttgtgggtttaatgttgagtggtctgttagtacaatata
ggagttaagagcttgaactgaagccaggcttttaaaagtaggatagttgacctttcttag
agtagatacttagagtagatacagatgttaaataagttaaaatgcaaagctcttggttta
gaaaatgtctgccattaaacatgctaattgttttttccttgcttagtgaaagtagttggg
atctattctcagtatagggaaccattttcacaaataatctgtgatctcttgccaaatatg
aacaaacatactggcccaatgactagtatagccaaataagtttttgagcctttattgcag
ttgcagttaactatatccgaaaatgggtatctttaagcaaagtgaagtaaagaattgcag
cttatcagtgatgttgtaaaaataaatgtctgaacatatgaatgcagtattgatttcagc
atttaactgagataagcgcattgaaatctgtttaacaaaaattaaaatggatgcatcgat
gttgctgaagtaacttgttcttgtttttgacatcgtgcagGCATGGATTCCGTGAAGGAA
CAACACCTAAACCCAAGAGGGCAGCTGTTGCAGCATCCAGTTCATCTTAAGAATGTCAAC
GATTAGTCATGCAATAAATGTTCTGGTTTTAAAAAATACATAtctggtgtttggtaaggt
atttttaatcaattaggcttgtagtatcagtgaaatactgtaggtttagggactgggcta
gcttcatatcagatttacttgttaagtgactgttttggaatgtttacttttggactgggt
ttgtaacacggttaaaggcaatgagaaacaagcagaattccaggagtccttgaagcagag
ggcactggaagacaatatagcagattaaaatagcacagctcatgtggcataggtgggtat
tttagatgtttgagtaaatttgaaagagtatgatgtttaaattacctttagcaacatgtt
catctgctatgctgtcatgactagggggatgattattagtcacatagagcttgggagtac
cactggaaacgtatgggtaggagtttaggtggcttctgtttttcaaaagatgatcttatc
ctagtatctgtaatgctcacttggcacacctgacttgtgggctgtgtgtaaggtggctag
ctaagtgaaaaaagcctgctaggtgtgagtcaacttaagaatatgtaaataggtttgaga
aaaagtagggctgggtgcaagtaaagattgagcaggaaataaaggaaaatcaagtataat
ccctgagatttgtagactaaaggcaatgatgtgggactacttggtcgaatttttttagcc
ctcaacttggtaattgggtgtttctgtgttaaagcactgaaacttgctgtcgtgccttcc
tagttttcgtggtttattgacagggttgggggttttttttgtttttttaaaatgaaggga
caaagtcaactggactgctgagtgagagggcaggggcagttgaagggaacatgaattgct
ggaacagctacataaaatagtgatgtagccaagtcatgctatttaaattataattctcca
ctgtgtttagaataacatctgaggttcttaacctggccttggaagggtatcacttttact
tgtaacctgaaatggctttata
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1030, 1608..1743, 1949..2033, 3640..3761
1028..1030, 1606..1743, 1949..2033, 3640..3709
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved