Pan_troglodytes Locus ENSPTRG00000030357
snOPY snoRNA Orthological Gene Database
Pan_troglodytes ENSPTRG00000030357
Pan_troglodytes
ENSPTRG00000030357
15
SNORD116, SNORD116, SNORD116, SNORD116, SNORD116, SNORD116
1186..1277, 4368..4459, 5450..5541, 6593..6684, 8069..8160, 8889..8980
11559
GGTAAGTATTGGTTTTTCAAAGGCACCTAATGTTCCATGTTTGCAGGTATGAGGACTAT
GCATGGATCAATGATGACTTCCATACATGGGTTCCTTGGAAAGTTGAACAAAATGAGTGA
AAACTTTATACTGTCATCCTCTTCAAACTGAGGTCCAGCACACTGCTTCAACAGGGGCTA
GAGACGGAGGTCTACCTCTCATTCATTGACGTGGGTTGCACCAAGGGGTCTGTCCAGGCT
TAGGATGGGGTTCTCTTTTGGCAAGGGGTAGCCCCAGGGGAGTGGGAGCTCCCATGCACA
GGAGATTCCTGGTGTAAAGGACATCTCTTAGTGAGGCCAGGGTAGCACACACACCATCTT
CAAGACTAGGTGAATGTGCAGGTGGCACAAAGGACTTAGGCTCTGTGTCCCCCAGTTTGT
TCTTGAGTCTTAGTTCTTGGTTCTCTCATCATCGGGAGGAAGGCAGGTCCTTCTCGTTGG
GAAGAGAGGACAAGGCTACACTTTTGCCTCATTTTTGGCTCATTTTTATCCTTGTCTACA
TACATAGATTTCTGGTCACCTGCATGCTTCACATCCAGGCCAGAGTGCCTCTGTTGTACC
CTCTGTGTTGTGAAGACATACAGTTGGCCTCCTGCCCTAAGCTGGGGCTGATAGGCAACG
AGTCTCTGGCTTATCTCAAACCTGGTGTAGGTCAAAGGCTTCCTCGTTAGGGGTGCAGGT
CCCCGAGGCTTTTGTGATCAACTCTGCAGGTGTGCACGGGTGTTTAAAGGGATGCTCAAC
ATCAGTTCTCTCTAGTGGGATTATGTACTCCATGGGCTCCCAGGATCCAGACGTGCATCC
CTGTGTCTATGCAGTTCTGCGTCCATAAACAGGTGAAGCCAGAGATGGGCAGATTGCAGA
TGTACTGCAGGGGGCCAGATGGCATGGCCCTCATGACCTCTGCACATGTCTGCCTTTCTC
AAACATGCCCATGTTTCATCTGTACCTCCCAGGTGGCATTGGCATGGAAGGAAGGACTGT
GTCTGTGAGGGATGATCATCCTCTCATGTGATCCTTGGAGATGCCAGGAAGCCCCTTGAC
ACATGTGGCATGGGCTCCTTCAGAGGCTTTTGGATCCGTCGTGAATGTAAGCAAGCCCTT
CCCAAAGCCCTGATTTTCCTCATTTGCAGAAACAAAGATTGTGCCTGGATCAATGATGAC
TTCCATATATACATTCCTTGGAAAGCTGAATAAAATGAATGAAAACTCTATACCATCATC
CTCATTGAACTGAGATCCCAGCATGCTGCTACATTGGAGGGCAAGGAGAGGGGGCCAACA
TCTGTTTGTTGACATGGTCTACACCTTGGCTTAGGATGTGGTCCTCTTTGGGCAAATGCA
AGTGTCTGGGCTTTTTGGGGTTCTGTAGCTGAGAGACAGCTTGGTTGAAGGAATTTCCTC
TGAGAAGGTGGGGTAAGCACACTGCCAGCCTGCAGAACTTGAAGCTGCAGATGGCACAGG
AAGCAGTAGCCAGTAGTCTCTTTGTGCATGACTGTGTGTGTCCTTGATTCATAGCTTTTT
GGTTTGTCGCCTCCCCGCTTGCACAGGAATACCATTGCTTTCCTTTGGGGAGAGAGCATG
TCATTCCTGGACACTTGTTCGGCTTACTTTCATTCTCAGTCGAGGATGTGGGAGTTCCCA
TGGTACTTGGGTAGCATCAGGGGCAGGCAGCCATGAGGTGGGTGGTGAGCTGATTTGCTT
TCTGCAGAGGAGCCCAGGGAGGGTATCCACATTGAACTCGTATGTCCATAGGAGGAAACC
CAAGTCCTTTGGTCCCTGCAGTGTACTGGTGGTGGGAAGGGGAGAGGGCTGTGCATGCAT
GTACCAAGCGACATTCCATGTGGGTCGTGGAGCAATGACTATGAGCCTCTTTTGGGAGTT
GTAGGGTGCCCATGCTCCATTTCATGATGACCTTGGGGTGCTGGGATGGGAATGACATTG
CAAGTCCCTGTGTTCCTGCCACTTCGCAGACTGACTTGGTTTGAGAGATCTGTGTTCAGG
AACCCCTGTGGGATGCTTGTCTGTGTTAGGCATTTGAGCAGATATTGGCCCAGGGTTTCT
ACCCTTCCATGGTTGTACATACTGCTGGAAGGGCTTGTTGCTCCCTCTGTATTGATGAGG
GGAAGTTTTGCCCAGGAGAGCCTGATGCCATTTGCCTCTGAACTGCTCAGGCACTTCAAT
GCAGTTGAGGTTAAGAGTGTGTCACTTCCCATGTCGTGGTAGCATCTTCTCAGAAAAGTG
ACCCGTCAAGGTCTCTGCACTTAAATTCTCCATTATCTTATGATGTTAGGTTATTTTCAA
ATTCCTCCTAATTCTTCACAACAGTCTTCTTTGTGAAATAGTCGTGAAGTTGTATGAGGG
CTATCATCCACAGGCCAGTGATGGAGAGGTTTTGTACTCTGTGGCCATGTTCACAGGCAA
GTGGCTTAAGACGTATGGTGTTCTCAGGGACAGCACCATAGAAGCCCTGTAGGATTCAGC
ATGTCTGATGCTTTTCTGGTTCCCTGAGCTGCACCTGTGAGGAAGGCCAGAGGTGGAGGT
TGATTTGTGATTGAAAGAGAATATCAATGCAAAGTGTGTGGAAGGAGCTTCAAGGCCGAA
GGAAAGTTGTTCTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCA
CTTTTTCCCTGCAGCTCTCCCCATTGAAATACCCTCATGGCTGTTGTCTTCTCTGATGGC
CAAGAGAATGGCTTTTGAGTCAGGGGTGGTGAAAGTGTGGTATTCAGAGAATTCTTCACG
CTTAGTGTTCTCTAGTTTGATGGTGCCCTTGAAATGCATGCCTGCCTTATACCTTCATGC
CTGGGTATATCTGTGCACACGTCCCCAAAGAGAGGTCACCCATGGGAGGTAGATATAGAA
TACAGCATGGCAGGAGGAATGGCATGGCCCTTGCAAACTGTGTACCTGCCTGCCTTTCTC
AAGCACACCTGTTTTTCCTCTGCACTTCCCAGGTGGCATGGGCATGCAAAGAAAGACAGA
GGCTGCAAGGGATGAACTTCATCTTGGGAGATCCCTGGAGATGGCAGGGAACCCATGGAC
ACATGTGGCATGGGCTCCTTTGGGTGCCGGTGGATCCCTTCATATGGTATGTGTTCATTT
CTCAAAAGACCCTAATGTTCTTCCTTTACAGGAATGAATCCTGTGCATGGACCAATGATG
ACTTCCATACATGCATTCCTTGGAAAGCTGAACAAAATGAGTGGGAACTCTGTACTACCA
TCTTAGCTGAACTGAGGTCCACCGGGGGCTATAGAGGGACAACTCTCATTTTTTTTGATG
CCCGTTGCATGAAGCGTTCGTCCAGGCTTAGGAAGGGATTCCGTTTGGGTGAAGGAGAGT
CACGGGAGTTGAGGCTATATGCACAGGACTTCTGTCTACAAGGCTGGGGTAGCACACATG
CAGTCCGTGGGACCAGGTGAATGTGCAGGTTGCTCAGGGAGAGTTAACCTGTAGCCTGCC
TCTGGGTAGCCAAGATTGTCCTTGACTCCTGGCTCTGGGTTCCCACAACCCCTGGAGGAA
GACAAGTAATTGTTCTTGGGAAGAGAGAACAAGGCCATACTTTTGCCTTTCTTTTTTTCA
TTCTTGGTTTGAGAACAGTGGAGTTCCAATCACCTGGCATAGCTTTCATGTTGTGTTCCA
TGCATTGTGAGTACATGCATATGGCAGGAACACACAGGTTCCCACTGCAAGCTGGGCCTG
ATAGGCAAGGAGTCTCTAGCTTAACCCCAGCCCAGTGTACGTCAATGGCTTCCTCATTAA
AATTGCATGGCCCTGTAGCTTTTGTGAGTGACATTATAGGTATCGATGTAAGGGTGTTGA
GAGGGATGCTCAATGTCAGTGCTCTTTAGTGTGCTGATGCACTACTACAAGGGCACCTGA
GCCCTTGTCCATGCGTTTCTGTGTCCAAAATCAGGTAAAGCCAGAGTTGGGTATCAACCA
GATACACTGCAGGGGATCAGAGGACATGGCCTTTGTGTACTGCACATCTGTCAGATTTTC
TCAAGCACACCCGTGTTTCCTCTTCACCTCCCACGTGGAAGTGATGAATTGGCCAGGACC
ATCTTGGTGAGGGACAATCATCATCTCATGTTAACCTCAGAGATGCCAGGAAGCTTCTGG
ACACACATGGTGTAGGCTTCCTTGGAGGCTGTTGGATCTCTCCTGAATGTAAGCAATTCC
TTCCCCGTGCACCCTGATTTTCCTCATTTGCAGAAACAAAGATTGTGCGTGGATCGATGA
TGACTTCCATATATACATTCCTTGGAAAGCTGAACAAAATGAGTGAAAACTCTATACCGT
CATTCTCGTCGAACTGAGGTCCAGCACATTACTCCAACAGGGGCTAGACAGAGAGGGCCA
ACATTCATTCGTTGACATGGGTTGCACCAAGGGGACCATCCAGGCTTAGGATGGGGTTTC
TTTGGGTGATTGGTAGACACAGGGGAGTAGGATCTCCCATGCACAGGACATACCTTGTTT
GAAGGACTTCTGTGTCCTAGGGCTGGATAACTCACGTGCTGTCTGGAGGACTAGGTGAAT
GGCAGATTGCATGGGAAGAGTTAACTGGTAGCCTGCCTCTGATGGCCAAGTTTGTCCTTG
AGTCCAAGCTCTGGGTACCAAAGTCCCCCAGAGGAAGACAGATCCTTCTGGTTGTGGGGA
GAGCAAAAGGCTACACCTTTGCCATTTGTTGGCTCATTTTATCCTTAGCTGAGGATGTTG
GAGTTGTGTTTACCCGGCATAGCCTCTGTGCCTATGTGCCCATGTTGTATACTGTGCATT
GTGAGGATGTATATTTGGCATGAACAGGCAGGCTTCCTCTCCAAACGGGCTGATAGACAG
CGAGGCTCTGGGTTATCCCAAACCAGATATAGGTCAATGGCTTCCTCTTTAGGGGTGCAG
GGCCTTGATTATTTTGTGACTGGCATCGCAGGTGTTGAAACAAGGGTATTGAGAAGGATG
CTCAACATCAGTGCTCTTTAGCGGGACGATGCATTCTGAGGGCTGCCATCCCCAAGATGA
GCATACTTGTGTCCATAAATTTCTGGGTTCACGAACAAGGGAAGCCAGAGACAGGCATAT
TCCAGATAAACCACAGGGGGAAGATAGCATGGCCCTCGTGACCTGTGCACCTGTCTGCCT
TTCTGAAGCATGCTTCTTTATCCTCTGCACTTCGCAGGTAGTGTTGGTGTAAAAGGCAAA
CCCGTGTCATGAGGGATGGTCATCATCTCGTGTGATCGTTGGAGATGGCAGGAAGCCCTG
GACATACATGGTGTGGGGGCTCCTCCAGAGGCTGTTGGAATCCTCCTGGATGTAAGTGAT
TCCATTCCAAAGCACCCTTAGTTTCCTCATTTGCAGGGATGGAGATTGTGTGTGGATCGA
TGATGACTTCCATATATACATTCCTTGGAAAGCTGAACAAAATGAGTGAAAACTCTATAC
CGTCATCCTCGTCAAACTGAGGTCCAGCACACTGCTCCATCAGGGGCTCGAGAGAGAGGA
ACAACATCCATTTGTTGACACAGACTGCACCAAGGCTTGGGGTGGGGTCTTTTTCTGGCA
GAGGAGAGTAGCTGGGAATTTTGGACGTTTGTAACTAAGAGACAGCTTGGTTGAAGGCAG
CCAGGTGTGTCGTCGGTTTGTACCTTGGGTCCCTTGACCTCCAGAGGAAGACTATTGCTT
CCACATGGGGAGACAGCACAAGGTCATTCCCAGGCACCTCTTTCACTCACTTTCATCCTT
GTCAAGGGACGTAGGACTTCCCATGGTGTTTGGATAGCATCAGGGGCAGGCAGTCTTCAG
GAGGATGGCGATGCTGATTTGCTTTCTGCAGAGGAGCCCAGAGAGGGTATCCACACTGAA
CTTGTATGTCCATAGGAGGAAACCCAAACCGCGTGGTCCCAGAAGGGTCCTGGTGGTTAG
AAGGGGAGAAAGCTGCACATGCATTTACCACACAGTCTTCTGTCTGGGTTGTGGAGAGAT
GACTGTGAGCCTCTTTTGGGTGTTATAGGGTGCATACGGTTTATTTTATGATGATCTTGG
GATGCTGGGATGGGAATGTAATTGCGAATCCATGTGTTCCCGCAACTCCACAGACTTGAC
TTGGTTTGGCAGGTTTGTGTTCAGGCCCTCTGTGGAATGCTTGTCTCCATTAAGAATTTG
AGATGGGGCTGGGCACGGTGGCTCACACCTTCTGGGTGCTTGAGCTGCACCTGTGAGAAA
GACCCCGAGGTGTAGGATGAATTGTGATTGAGCATGTTTCTTGAATGCGAAGTGTGTTGA
TGGATGCTTGCAGTAAAAATGCTTCAAGGCTAAAGGAAAATTGCCCTATGCACAGGAAGA
GTTTTTTTTCCCCAAAACTCTCCCCATTCAAATATCTCTATGGTCTCTGTCTTCTCTGAT
GGCCAAGGGAAGGGCTTTTGAGTCGGGGCACCAAACGAGTGGTGTCCAGAGTTCTTCACA
TTTAGTGCTCTGAAGCTTGCTGGTGCCCTCAAAATGTATGTGTGCCTCAAACCTTCATGC
ACGGGTACTCCCATGTACACATCCTGAAATGGGTATCCCATGGGAAGTAGCGATAGGGTA
TCCCACAGGGGGTTGAATGGCGTGGCCCTTGTGACCTATGTGTTTGCCTGCCTTTCTCAA
GCACACCCGTGTTGCCTCTGTACTTCCTAGGTGGTGTGGGCATGGAAGGAAGGCCAGTGG
AGACAATGGATGATCTTGTTCTTAGCAGATCACTGGACGTGGCAGGGAGTCCTAGGACAT
GTGTGGTGTGGGCTTCTTCAGGTGCTGGTAAGTATCTATTCCCCAAAACCCCCTAATGTT
ACTCCTTTGTGGGCATGAAGACTGTGCATGGATCGATGATGACTTTCATACATGCATTCC
TTGGAAAGCTGAACAAAATGAGTGAAAACTCTATACCGTCATCCTCGTCGAACTGAGGTC
CAGCACATTGCTCTTACAGGGGCTGGAGTGAGGGCCAAGTTTCATTTGTTGCTGCAGGTT
GCACCAAGGGGTTTGTTCAGTTGTAGGAGGGGCTCCCTTTCTGCAAGGGGTAGTCACAGG
GTTGTGAGATCTCTCATAAATAGGAAATTGTTTTAGGGACTTCTCTCTGCAAGGTAACAC
ACACACACCGTCTGTAGGACTATGTGAATGTGAAGGTGACATGGGAAGACTTAGCCTGTA
GCCTCCCTCTGGTGGCCATATTTGTCCTTGAGTCTTAGCTCTGGGTTCCATCATTCCCTT
GAGGAAAGACAGGTGTTTGTGCTTGGGAAGAGAGCACAAGGCCCCACCTTTGCTGTTTTT
TCCACTCATTTTCATCATTGTTCAAGGACATTGCAGTTCTGGTTTTATCCATAAACAGGG
AAGCCAGAGACAGGCAGATAGCAGATATGCCATAGGGAGCCAGATGACACGGCCCTCATG
ACCTGTGAATGTGTCTGCTTTTTTGAAGCACACTCGTATTTCCTCTGCACTTCCCAGGTG
GTGTTGGCATGAGGAAAGGAGGTATCTTCGAGGGACAATCTTCTTCTTGTGCGATCCTTG
GAGATGCCATGAGGCCCCTGGACACATGTGGTGTGGGCTCCTTTGGAGGCTGTTGTATCC
CTTCTGAATGTAAGTGTCCACTTTCCAAAGTCCTGATTTTCCTCATTTTCGGGCATGAAT
AATGTGCATGGATCGATGATGACTTCCATATATACATTCCTTGGAAAGCTGAACAAAATG
AGTGAAAACTCTATACCGTCATCCTCGTCGAACTGAGGTCCAGCACACTGTTCATCAGGG
GCTAGAGAGAGGGACAACATCCATTTGTTGACACAGGCTGCATCAATGCTTGGGATGGGA
TCGTCTTTGGGTGAAGTGGAGTAGCTGGGCATTTTGGACTTCTGTGGCTGAGAGACAGCT
TGGTTGAAGCTCTTCCCTCTGTGTGGCTATGTGTGTTATCGATTCATACCCCTTGGCTCC
TGCACTCCCCAGAGGAAGACAGTTACTTCTGCATGGGGACACAGCACAATGTTGTTCCCA
GGCACTTCTTCGGTCACTTTTATCCTAAGTCGGGGACATGGGAGTTCCTGTGGTGTATGG
GTATCATCAAGGGCAGGCAGTCGTGAGGAGGGTGGCATACTGATTTGCTTTCTGCAGAGA
AGCCCAGAGAGGGTATCCACGTTGAACTTGTATGTCCATAGGAGGGGGAAACCCAAGTCC
CGTGGCCCCTGAAGCATCCTGGCAGTGGAAGGGGAGAGGGCCGTGCATGCGTGTACCAAC
AGCCTTCTGTCTGGGTCACAGAGCGATGACTGTGAGCCTCTTTCGGGCATTGTAGGGTGC
CCATAGTCCATTTCATGATGACCTCAGGGTGCTGGGATGGGAACGTAATTGTAGGTCCAC
GTGCTCCTGCATCTCTGCAGACTGACTTGGTTTGGAAGGTCTGTGTTGAGGAACCTCTGT
GGGATGCTTTTCCTTGGTGCATTTGAGGTGTCTGATAATGAGTGTGTGGGTTTCTGTATC
CTGGTGACTTCTACTCAGAAATGTGACCCAGCAAGGTCTCTGTGCTTAAATACCTTAGTG
GCTTGTGATGTTAGGTTATTTTCAAATTCCTCCTAATTGTGTGTGACAATTCACACAAGT
CTTTGTGAAGTTGTCCTTGAATTGTATGACAGGGCTAGTGTCTGTAGGCCAGTGATGGAT
ACGTTTTGGACTCCACAGCCATGTTCACAGCCAAGTGCCTTAAGATGTATGGTGTTCTTA
GTCATAGTGCCTTGGAAGCCCTGTAGGATTCAGCATGTCTCGTGCTCTTCTGGGTCCCCG
AGCTGTACCTTTGAGGAAAACCCAGAGGTGGAGGTTGATTTGTGATTGAGCATGTTTCTC
AGTGGGAAGAGTGTCGAAGGAGCCTGGGGTGAAAGTACTTCAGGACCAAAGGAAAATTGC
CCTTCACTCAAGAAGAGGCTTTCCTTGAACCTGTCCCCACTGAAATATCCTCATGGCCTT
CGTCTTCTCTGATGGCCAAAAGCAGGACTTTTGATTCAGAGGTGGCAAATGAGTGGTGTT
GAGAGAGTTTGTTATGCTTGGTGCTCTGTAGCTGGAAGGAGCCCTCAAAATTCTTGTGTG
CATGATAGCTTCATGCCTGCTTACACCCATGCACATGTCCCAATAAGAGTGGCTGCCTGT
GGGAGATACATACACGATACACCACAGTGGAATGAATTGTATGGCCCTTGCAATGTGTGT
ACCTGCCTGCTGTTCTCAAACACACCTGTTTTTCCTCTGAACTTTCCAGGTGGCGTGGGC
ATAGAAGGAAGGCCAGTGGCCATGAGGGACAATCTTGGTCTTGGGAGATCCTGGAAATGA
TAGGGAGTCCCTTGATATGTGTGGCATGGGCTCCTTCAGGTGCTAGTGGATTCCTTAGGA
TGGTAAGTGTCCATTTCTCAGAAGCTCCAGATATTCCTCCTCTGCAGGAACAAAGACTGT
GCCTGGATCGATGATGACTTCCATATATACATTCCTTGGAAAGCTGAACAAAATGAGTGA
AAACTCTATACCGTCATCCTCGTCGAACTGAGGTCCAGCACATTACTCCATCAGGGGCTA
GACAGAGAGGGCCAACATTCGTTTGTTGATATGGGTTGCATCAAGGGGTCCATCCAGGCT
TAGGATGGGGTCTCGTTTGGGCAAAGGAGAATGGCAGGGGAGTGGAGGCTATGTACACAG
GAGATTCCTTGTTTGAAGGACTCTATTTGTGAGGCCAGGGTACCACACGTGCTGTCCGCA
GGAGTAGGTGAATGTGCAGGTTGCCCAGGAAGAGTTAGCCTGTAGCCTGCCTCTGCATGG
CAGTTTGTCCTTGGGTCCTGGCTCTGGGTTTCCATGTTCCTTGGAGGAGGATAGGTGATT
TTGCTTGAGAAGACAGCACAGTACCATACTTTTGTTGTTTTTCTGCTCATTTCATCATCC
ATTGAGGACAATGAAGTTGTGGTCAGCAGGCATAGCTTTCAGGCCAGCGTGCCCATGTTG
TGTCCCATGCATTGTGAGCACATGCATGTGGCATGAACACGTAGGCTGCCACTCCAAGCT
GAGTCTGATAGGCAATGAGACTCTGGCTTATCCTGATCCCGGTGTAGATCAAAGTCTTCC
CAGTAGGATTGCATGGCCCCGAGGCTATTGTGAGCTGCATTGCAGGTGTGGAAGCAAGGG
TGTTGAGAGGGATGCTCAACATTAGTGCTCTTTAGCGAGATGATGCACTATAAGGGCACC
CTGAACCCAGACATGCATCCCTATGTACGTGCATTTCTGTGTCCATAAATAGTTGAAGCC
AGACAGCCAGATTCCAGATGTATCGCAGGGGGCTGGATGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1125, 4172..4305, 6397..6530, 7890..8006, 8697..8828, 10489..10559
6464..6530, 7890..8006, 8697..8828, 10489..10556
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved