Pan_troglodytes Locus XR_022285.1
snOPY snoRNA Orthological Gene Database
Pan_troglodytes XR_022285.1
Pan_troglodytes
XR_022285.1
16
SNORA64, SNORA64
2522..2655, 3162..3294
4575
GTCCAAAGCCAGGAAAGACGAGGAGGCATCTCGCTAGGGTTCTCCCCGCCACGACGTGA
ACATATGCACTTGCCAGGCTGATAGGCGAGTCGGGGCCCCAAGAACACCCGCACGCAGTG
AGTTAGACAAAACAGCTTTATTTGAAAGACGTGGGACAGCCAAGTTCCCCCAACCCCGCG
GTCCTGGCGACGTCGGTGTCAGGCGTGGGAGGCCCAGTGTCCTGCGGAGAAAAAAACAAG
GTTAGCGGTCTGCAGTCGGGGTCAGGAGTCAGGGGCCAGACCTCGCGAGCGACCGCACCC
GGGGGGGAGGCCGCAGCGCCTGTCGGGGCCTGGGTTTCACCGCCGCACATGGGGCAGCGC
GCGGTGAGCTGAGGCCCCCGGGGGCTCTGGGCGCCGAATCTCACCCGCGGCCACGGCCAA
AGCCGGGGGTGATTTTCAACCAACGCCGGTCTCGAAGACCACCAGCGGGACCCCAGGGGT
CAACGCGGCAGGACCTACCTAAGTGAAGAGGGGAGCGCAAAGGAGGCGCGGACGTTTATA
GCCACTCTTCGGGTGACGTAGATTCCCGAGCCGCGGCTGGGGACGGAGGCGCGGGCGTTT
ATAGTAGCTTTTCGGCTGACGTAGATTCCCGGGCCGCGGCTGGGGCCGGACGGGCAAGAG
CACTCAGAGCCCGGTGAGGGCGGGGCACCGCGGAGCCAATCACAGGTTGTCTTATAGAAG
CTCGGCCCGCTCCCGCTTGGGGCGGGGCTGCGGAGATCTCGCGGCGCTTGGCGTGCTATA
AAAGCTGCTTCCCAGTAGGCCTCGTTCTTCTTTTCCGACAAAACACGTGAGTTATGCTGG
TCGCTGCAGCGGGCCTCTGCGTGGGCGGCGGGAATCCGCGGACATCGGGTCGGGTCCAGG
CTCCCGAGTCCGCGCTCCTGGGCGGGAGCCCTTGTCTGGGTCTCCCGGGGGGCTGCCAGA
TGCGTAGGCCACACTGACTAGTTCCTTCTTGTCGCTTTTTCCAGCAAATGGCGGATGACG
CCGGTGCAGCGGGGGGGCCCGGAGGCCCTGGTGGCCCGGGGATGGGGAACCGCGGTGGCT
TCCGCGGAGGTTTCGGCAGTGGCATCCGGGGCCGGGGTCGCGGCCGTGGACGGGGCCGGG
GCCGAGGCCGCGGAGCTCGCGGAGGCAAGGCCGAGGATAAAGAGGTAGGTATCAGCCACG
CTCGGGGTCGGGCCCCTGGGCGGCGCCGGAGAGCAGTCCTGGTCACTGGCGCCTTTTCTC
CCTTTAGTGGATGCCCGTCACCAAGTTGGGCCGGTTGGTCAAGGACATGAAGATCAAGTC
CCTGGAAGAGATCTATCTCTTCTCCCTGCCCATTAAGGTACGCGTCGGTCGTTGGGGCGT
TGAGCAAGTGCGACCCAGGAGTCACTTGGGCTGGGGTTGGAGGATTAGTATCTGCCATTG
ACCCGCATTAAAGGGCCCAGCGTCTCGCTTGAGAGGTTGAGGTTGTGTTGCGGGCTGGCT
GAGGAGAGGATTCCACTTAGAGGTTGGATGGATACCTGAGTGAAGCCAGAGCCACAAAAG
GCATTTCAGCGCATCTTCCCACATTCGCAGCGAATTCATTTCCAAAGAACTGAAAGAGAA
GCAGCGCTTGGTTCATGCCATGCGAGAGGATGATGAAGTTCAGGTTGTGGGAGGACACTG
TAAGGGTTGGCAAACTGTCATAGTCCGCGTGTACGGGACAGCTGCCATCTGCGTCCAGCG
GGTGCAGTGGGGAAAGGCTAATGGCATATTTGTCATGTGAGCGTTCGCCCTAGCAAGGTA
CGGTGGTCATGGCTAGGCCAAAGCTGGACAAAGCAAAAGGAAATCTGAGTGGAAAGCCAC
ATCTCACCAAACAAGAGGAAAAGGGCAAATAGGAAGAAACGATTGAGATGCAGAAATACG
GTAACCTTACATACAAGCCTCCAAAAACGAAGGGGACAGATCGGGGGGAAGCCAGGTGAG
GGGGTTCATGACTTCGGTTTTTTTTTGGGCGGGGGGGGGGCGGTTACAGAGTTTCGTCCT
GTCGCCTAGGCTGGCGCGATCTCGGCTCACTGCAACCTCTGCCTCCCAGGTTCAAGCGAT
TCTCCTGCCTCAGCCTCCTGAATAGCTGGGGTTACAGGCGCACTCCACCATGCCCGGCTA
ATTTTTTGTGTCTTTAATAGAGATGGGGTTTCACCATGTGGGCCAGGCTGGTCTCGAACT
CCTGACCTTGTGATCCGCCCACCTCAGTCTCCCAAAGTGCTGGGATTACAGGCGTGAGCC
ACCGCCCCCGGCCGTGACTTTGGTTCTTGAATAGCGTAATGGTATTAAGTTTTTTTTTAA
TGCTCTCCCTACAATTTTCTTGTTTGTTTCAGGAATCAGAGATCATTGATTTCTTCCTGG
GGGCCTCTCTCAAGGATGAGGTTTTGAAGATTATGCCAGTGCAGAAGCAGACCCGTGCCG
GCCAGCGCACCAGGTTCAAGGTACCCGGCTGTCCTGGAGCGGGCTGCGCTGGGCTTGCTG
GGACTCTCTCGGCTCTGCATAGTTGCACTTGGCTTCACCCGTGTGACTTTCGTAACGGGG
AGAGAGAGAAAAGATCTCCTCAGGACCTCGGATGGGCCTTACTGTGGCCTCTCTTTCCTT
GAGGGGCGCAACAGGCCCTGGGCGGTGGGCAGTGATTGGGTGTAGGGCCACCAGCTGCCT
CACACACATCTCTTCGCAGGCATTTGTTGCTATCGGGGACTACAATGGCCACGTCGGTCT
GGGTGTTAAGTGCTCCAAGGAGGTGGCCACCGCCATCCGTGGGGCCATCATCCTGGCCAA
GCTCTCCATCGTCCCCGTGCGCAGAGGCTACTGGGGGAACAAGATCGGCAAGCCCCACAC
TGTCCCTTGCAAGGTAGGCTGGTGGCAGGTGATGGGCCTGCCGTGGGGCAGGCTCCCTCG
GGCCCCCGTCTCCTGACTCCTTCCCTCACCAGGTGACAGGCCGCTGCGGCTCTGTGCTGG
TACGCCTCATCCCTGCACCCAGGGGCACTGGCATCGTCTCCGCACCTGTGCCTAAGAAGC
TGCTCATGATGGCTGGTATCGATGACTGCTACACCTCAGCCCGGGGCTGCACTGCCACCC
TGGGCAACTTCGGTAGGTGGTCCACACATGGGTCATAGCCATGGTCTCTCAGCTCCGCTT
AACCACACGGGTCCAGTGTGTGCTTGGCGTGTTTTCAGGGAGGCAGAGAAAGGCTCTCCT
AATGCACGACAGACCCGCCCAGAATGGCCTCTCTGTTCCTAGGAGTGCGACAATTTTTGG
GTTGGGGGACTTGCCTCAAGCACACCACTGACCCTCCTGGGCTTCTTTTGTTTTGCAGCC
AAGGCCACCTTTGATGCCATTTCTAAGACCTACAGCTACCTGACCCCCGACCTCTGGAAG
GAGACTGTATTTACCAAGTCTCCCTATCAGGAATTCACTGACCACCTCGTCAAGACCCAC
ACCAGAGTCTCCGTGCAGCGGACTCAGGCTCCAGCTGTGGCTACAACATAGGGTTTTTAT
ACAAGAAAAATAAAGTGAATTAAGCGTGTTACTGTTTTTTTCCCGTGTCCTGCATGGTTA
GTGGTGGTTTGAATCTGGGGTGTGGGGCCAATAGATCACACCAGACACACAGGCAGGTTG
CAGGGCTTTTATATTTCAGCAACAGTCATACAGAGCCACACAGCAGGGGCACCCACAGCT
GCCTCAGGAGGTGGCAGCGGCGGCCTCTTTTGCAGCTTTTCTCTCTTGCAGCATCCTCTG
CCTCTGTTTGGCCAGGCACTTCCTGGCAGAACTGTAGGCCCCCAGGTCCTGATCTGGGGA
AGCAATGGAAACAAGCTGGGAACCGAGGCCTCTGCTACATGCAAAGGGGGCAAAGTCAAG
TGAGCACAAGGGAGGGGAGGGAAGATTCGCAATGGTTCTGGCCCCCAGGCCTCAGGAGGA
TGGTGGGGGGTTGGGGGTGGGTGGGGCACGCACAGCGGTCCTGGTAGGCCTTGGCCACCT
GGGTGAACTGCTCCACTTCCTTGATACAGTTCTGCTGGTAGTTCTGTCCTTCCCTCTGCT
GACAGGCTTTGAGCCGATCCTGCATAATGTTGATAATTTCTTGGTCGACTTTGCTGGTGG
AGAAAAGGAGCAAGAGAGGCTAATCACAAGGAATCCTTTTCCTGTACCCTGTGAGAACAA
TTGAAAGCAAGAGCCCTGGGGTCTGGCTCCTCCCATGTCACCCCTAAAATCTGGGCATGC
CACCCTGTGGCATCCCAGGGACTGGTGTCCCAGCAGCACATGGTGCAGATCTCCACACTC
CCAGCATGGCTCACGTACTAGTCCCTCCTCCACTGCATTTCGGCTTCATACATGCACATG
ATGTCCTCCTCTTTGCACTCAGTGATGTCCGGCACGCGGCGGTACTGCCGGTGGTAGTAG
TAATACCTGTTCTTTGCGTGCTGCCGCTCTATAAATTCTGCAAAGACAAAGCCACAGACT
CAAACGCCTCATCGGTTTGGACAGGCTTTTAGCTTTCTTATTTCTCATAAGCCCTTTGGA
GGGGAGAGAGGAGAAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1183, 1267..1356, 2372..2479, 2719..2892, 2972..3131, 3358..3575
1007..1183, 1267..1356, 2372..2479, 2719..2892, 2972..3131, 3358..3527
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved