Pan_troglodytes Locus ENSPTRG00000010012
snOPY snoRNA Orthological Gene Database
Pan_troglodytes ENSPTRG00000010012
Pan_troglodytes
ENSPTRG00000010012
18
SNORD58
1098..1162
4009
CTGCGTTGCTCCGAGGGCTCAATCCTCCTGCCATCGCCGCCATCCTGGCTTCGGGGGCG
CCGGCCTCCAGGCCCCCGGGAGGAGAACTCCTAGCGCTACTAAATCCTCGCTGGAGGCGG
TGGTTTCTTATGCGGGAGGACGTGGCGGAGGGCCTGACTTTGGGAGCCGGGGTCAGTCGG
CCTCTGAGGTCCGCAGAGGGACGTGATGGGCGGCAATGGGGACGACCGGGCTCCTCCACT
GGTGGAGGCGCCGGCCCGCCGTGGGGTGCGGGCCGCCTGTGGTCCGTGCGGACTCCGGAG
GTCCGGTGTCTAGTGGTGAGTGGTGGCCGCAACGAGGAAAACGTTTTGGGGGAAAGAAAA
GTCGGGTGGAGGCGTTACACGTTACTACAAGAGTGTTGCGTACTGGAGGGCTCTTAACGT
GGGTCATAGCCCGAAGGTGTTGAGAGAGACGGCACTCACTACCTGCAGCCCTGACAGCAA
AGGGGTTTCTGTAGAGCGGGAGGGAGGAGGTGTAGAGGGTTATAGTTGAGTTGTGCCATG
TGGATGCGTCGAGTCATTTTACGCCTGGAAGATCCAGCATTGGATTGAAACAGGCTGTAT
TTTCTTCCAAAGGGTTGACTGGATTGGTGAGGCCCATGTGGCTACTTCTGTGGAAGCAGT
GCTGTAGTTACTGGCAGATAAAAGGGAAAGCAAGCCCTTGGTGGGGGAAAGTATGGCTGC
GATGATGGCATTTCTTAGGACACCTTTGGATTAATAATGAAAACAACTACTCTCTGAGCA
GCTGTTCGAATCATCTGATATTTATACTGAATGAGTTACTGTAAGTACGTATTGACAGAA
TTACACTGTACTTTCCTCTAGGTAATCTGTGAAAATGGTTCGCTATTCACTTGACCCGGA
GAACCCCACGAAATGTAAGTGGACAGGAGGTAGATACCTATTTCCTACTTGGGGGTTGGC
ATAAGATACCAAAAATTAACCAAAACGTTTTATTTTCTAGCATGCAAATCAAGAGGTTCC
AATCTTCGTGTTCACTTCAAGGTATGCGATTCATAGTTGTGATCCAACAGTTCCTCATGT
TCCACTCAAAAAAGGTAGCTGCAGTGATGACTTTCTTAGGTCACCTTTGGATTTACCGTG
AAAATTAATAAATTCTGAGCAGCCACCTTATATTTAGGCATTGATGATCAGGGTGTAAGG
ATGTAGCGTTTGTACCAGAAAACCATTTGGAAATCTAGTGTGCAGATCAAGATGGAGCAT
TTTAATTGTAATTACATGGTGATGGAATTTAAACATTTTATAGTGAATAAATGGAGTTTT
GGAGTTTTCTCTAGCTTCAACGAAGTTTACCTGGCTTTTAGTCACAAGTTTTTTTAATTG
CCTTGCCCCCAAAGAATAGAAATAACTCGACATTTTGAAAAGCTGAAAATTTAATGTTTA
CTTTAAAAATTAAAGCTTTGATCTAGTTAACCAACACTTTATTCTTCATACTTAGAACAC
TCGTGAAACTGCTCAGGCCATCAAGGGTATGCATATACGAAAAGCCACGAAGTATCTGAA
AGATGTCACTTTACAGAAACAGTGTGTACCATTCCGACGTTACAATGGTGGAGTTGGCAG
GTGTGCGCAGGTGAGAATTCTTAGTTGCCATTTGAAAAGACAGATTTTAATGGAAAAGTG
ATGGGATAGGATAAGAATGGCTAAGATCTGTGCTGATGAACCTATTTCTGGTTGCTGTAA
TGACAGGACACCGTGGATTGATGGTGAAATAAACCATATCCTAAGAAACCTTGATATCAG
ATAAAATAAATTCATCTTGGCTGTAACGTTAATTTAAATCAAGGAAAATGACTCATCATC
TCCATTTTCTTTCAGGCCAAGCAGTGGGGCTGGACACAAGGTCGGTGGCCCAAAAAGAGT
GCTGAATTTTTGCTGCACATGCTTAAAAACGCAGAGAGTAATGCTGAACTTAAGGTACCC
AAACCATTAACATCCTGTGCAACTTGGGTGGTTGTTTAATTAATGTTGGCTGTTCAGATT
TATGTCCTTGATTTTCTTGTTTTCAGTAATTAACTCATTTAGGATTTTTTAAATTTCTAC
CTGCAGTTTCCACAGAATGAAACTATTTCCTTTTATTTTCTTTTGAGTCCCTTTATGGCA
AAATTCTGTGAAGATCCAGAAGCGTGCTCTGTGGTCTCTTTAAGCCTAACACTTAGTATT
TCTAGTTTTCTGCTGTCTTTTTAACACTGGAGGTACTTTACCAGGGGCTTTTACCCCTTT
TTGTGACATACACCTTTGATAGTATGATTAATTATCAAAATGATTGCCTTAGCAGTGATT
AATGTGGTTTGTGGCCTACCTTCATAATGGAGAGTCATGTTGCATTTCAGAAAGAAATTG
TTTAAAATTTCAAAAAGTTTAAACAATGACAAACTTGTGTTGACAAAACACAAATTTCTC
CATTTTGTATATTACCCATTAGCCTTTTGCATTTGAAGGTCTGGGCCAGAACTGGAATTA
GTTTAGGTCTGTATGGCTCCAAACCTTCTAAGCCATGCTGAGAAATTTTGTTTATCATCA
AGACTTCGAATTAGGTTCTTCCTTACCCCTCAGCTCTCCACCCGTCTAAGGATCTTTGGG
AAGGCCACTCATAGACAAAATGTATAGCACACTGAGTTTGGTGGCAATTTAGACATGTAA
AGGTGAAGGCAGACAACTGCTTTAAAAAATGCTATTTGCAGAATAAAAGGATTGCCTTTC
AAAAATGATTTCATTGAGGCAGGACTTTGGAGCAAGCCTGGGAATTCATATTTAGCAATG
ATAGTTTGTGGTGTTTTACTAATTAAGGATGTTCCTGGTTTCATGCTCTTTCCTTTCTTC
CCCAGGGTTTAGATGTAGATTCTCTGGTCATTGAGCATATCCAAGTGAACAAAGCACCTA
AGATGCGCCGCCGGACTTACAGAGCTCATGGTCGGATTAACCCATACATGAGCTCTCCCT
GCCACATTGAGATGATCCTTACGGAAAAGGAACAGATTGTTCCTAAACCAGAAGAGGAGG
TTGCCCAGAAGAAAAAGGTAAATAAGTAGTTGCTCGGTTTTGTTTGTGATAGTAGAAAGA
TTTGTGGTTGCTGTGATGACTATCTTAGGACACCTTTGGAATAACTATGAAAGAAAACTA
TTCTGAGCAACCCTTTCACCTGTCTTATTTTGGCTTTTGTAAGTTTGTTTCTTGACTAAT
AATAAATGGTAAGTTTTCTGTAATCCCAGCACTTCGGGAGGCTGAGGTGGGTGGATCACA
AGGTCAGGAGATCGAGACCATCCTGGCTAACACAGTGAAACCCCGTCTCTACTAAAAATG
CAAAAAAAATTAGCTGGGCATTGTGGCGGGTGCCTGTAGTCCCAGCTACTCAGGAGGCTG
AGGCAGGAGAATGGCGTGAACCCGGGAGGAGGCACTTGGAGTGAGCCGAGATCGTGCCAC
TGCACTCCAGCCTGGGTGACAGAGTGAGACGCTGTCTCAAAAAAAAAAAAAATGGTAGTT
TTATATTCAATACCTCAGGCCCGTATGATTATCTGCTGATGGCCCCACTTAGATGTACAT
AGCCACTTCAAAATGGGCCCTCTCCCCAAATCTAAGAAGCTTGTTTTCAGTAATTGATCA
CATTTAGTTCTTTTAAGTCAAGAACCTGAGTGATTCTGTACACTTCTTTTTACATCTAAT
GAACTTAAGTTCTGTTGATTTCTACCATTTAAGTATTTTTCCCCCTTAGTCCTTAACGAC
TAGGTTTCCTGCCTCCAAAATAAGCTGAAGTCTTCCAAGATGTACTGTGGTTTTCTCCAA
GAAACTTAACAACACATTTTTCTTTCCCCAGATATCCCAGAAGAAACTGAAGAAACAAAA
ACTTATGGCACGGGAGTAAATTCAGCATTAAAATAAATGTAATTAAAAGGAAAAGAATGT
TGGTTGTCTTTATTAGTGAACATATTTCAAGTGTCCTTACAAGATGGATC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1015, 1018..1041, 1495..1629, 1875..1973, 2885..2980, 2983..3009
1001..1015, 1018..1041, 1495..1629, 1875..1973, 2885..2980, 2983..3006
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved