Pan_troglodytes Locus XR_023652.1
snOPY snoRNA Orthological Gene Database
Pan_troglodytes XR_023652.1
Pan_troglodytes
XR_023652.1
11
SNORD14, SNORD14, SNORD14
3715..3802, 4142..4228, 4976..5059
6625
ACGGAGGTGGGAAGGGGCCTAACGGTCAGGGCTCAGAGAAGCGGTTTCGCCTTCTTTTC
CGCGGAGGGGTCCAGACACGACCGCGTCCTGAGGCGGTTCTGAAAAGCCGGGCCCCTTAA
ACCTCTGCGTCGCGGGCTACCTCCCAACAGTTGCCGTAGGGAAATGCAGGTGCTGGGAGG
CCTGCCGAGCTAACCCGCCCCACCCCGCGGCGGCCTGGCGGCTCCCTCCAATCCCAATCC
TTGGGGGCCGTGAGCGAGCAGCCCTAGTAGCACCCTGAAGCCGGAACCTTCGCCCCAGCC
CCTCGGGTCAGCCCTTGCCCAAAGCCACGCTATGAAATACAGATTCGCGAAACCCGGGGC
ACTCAGAGGCCCGTCTGGAACACGAAGGTGGGGCGTGGAAAGGAGGAATGAGGACGTGGG
TGGGGGAGGGAAGCAACAACCTTCGCAGCCATTTTGTCCTCGCTCCACTTCCGTCTTCTC
CTGCCCGGCTCCCGCGCCCAAACCCCTCCCTTCAGGCCCCGCGCGATTCCTCCCCCAGTT
CTGTGCCGGCCAAGATCCCGGCTAGCGCCGCTATCATTGGTTGGTTCCAAGTTTGCCCGC
CCCTCTTCCTCCTCCTTTTTCCGCCCCCTCCCTCCCGCGGAAGCTGGGGGCGCATGCGTA
GAGGCGGACGCTCCCTTCCCCCGCCCGGGGTAACTGAGGACTCCCGCGCGCGGGCTCTCT
GCGCCCCACCCTCCCTTTCCTCGGGGCCGTCCGGAGAGCGGGGGCGAGCTTGAAAGTTCC
AGAACGCTGCGGTGAGTGCGTTATCGTGAGGCGGAGCGCGGTGGGGTGGGTGCGGAAGGG
GGCGAGGCCCGAGGAGTGGAGCCGGGCTTGTGATTGGGTCTTGTAAGGGCAGCCGGGCGT
CTATTGGCCGGGGAAGCCGTAATGGCAGGCAGCAGGGGCGGGCCCCTTCTGGAAGGTTCT
AAGATAGGGTATAAGAGGCAGGGTGGCGGGCGGAAACCGGTCTCATTGAACTCGCCTGCA
GCTCTTGGGGTTTTTGTGGCTTTCTTCGTTATTGGAGCCAGGCCTACACGCCAGGTAAAA
CCTCTGCTCAAGAGTTGGGTTGTGGGTCTGGGAGCGTGTAGCCTCCACACAGGCCGGTTG
GGCTTGCTGAGGCTTGGAGGGTTCTGAGAATCTCGTCGAGGCGAGTGTGCGGCTCCTTCT
ACCGGCTTAAGGGGCCTCAGTTTTCGGTGGGATGGCAGCGGTATTTGGTTGCAGCCGGCA
GGACGGAAATGTAGGGAGTGGGCCGCAGTGGCCCCAGGGGAGGCTGGGAGACGCCCGGCG
GCCGCGTGGCGGGGGAGGGTTGCTGCATCGGTTTGCCTGGCGCGCAGGGAAGTGGAGCCA
GCGTTTTCTTTCACCCAGTTCCCTGCTTAGTCCAGTCCCACCGTGGTTCTTCAGAGCCGT
TCTTGGCGTGCTTCCAGTATGGGGGTACATTCCGGAGTAGTTAAAAGCCCGTTGACTCCC
GGGGGCACTGGCACCTGGCGAGGGAGGGGAACAGATAGTGCTCAGTTCGGGGTAAGACCA
CGTGTTTAGCAACGCCCCACGCCGTCTGGGTAGATGGGTCCTTCATCTAGGGCGTGCTCT
GCTGCGGTTGGCACGGCAACCTGGACTGCAGCACTAGTTCTGGACCTCCCGTGTGCTTAG
ACGAGAGGTGATGGGCACTATTATCTCTTGGCAGTGGCCATACCTTTTTCCTGGTTATGT
GTTTTGTTAAGAGATGAGGGAAATATTTTGATGAATTGAATTTTTAAACCAGATTTTTCT
TTTTTTCAGCAACCATGTCCAAGGGACCTGCAGTTGGTATTGATCTTGGCACCACCTACT
CTTGTGTGGGTGTTTTCCAGCACGGAAAAGTCGAGATAATTGCCAATGATCAGGGAAACC
GAACCACTCCAAGCTACGTCGCCTTTACGGACACTGAACGGTTGATCGGTGATGCCGCAA
AGAATCAAGTTGCAATGAACCCCACCAACACAGTTTTTGGTGAGTTACTAATTTTAAATG
ACAGAACAAATATAACAGGGCTAGGAAGCACAAAAGTTTATGAAACGTGAGGAGGGAGCT
TTTTGATTTTAGAAAAACTGAGCTGAGAGACTTGTTCTCAAGTCTGTTATAAAACAGGTG
GTAGAAACCTTTCAGGCTGAAATCTAGATAACGTAGGAGGTTGAAGTTTGAACCTTTGCT
ACCTATATGGTAGTTGAATTCACCTACCTATGAACTCTTAGGTATTTGAGTAATCATGGA
CTTGAGTTTTATCAGAAGAGCTATGAAATTGAAAGTGTTTTCATTTGATACCTTTTACAG
ATGCCAAACGTCTGATTGGACGCAGATTTGATGATGCTGTTGTCCAGTCTGATATGAAAC
ATTGGCCGTTCATGGTGGTGAATGATGCTGGCAGGCCCAAGGTCCAAGTAGAATACAAGG
GAGAGACCAAAAGCTTCTATCCAGAGGAGGTGTCCTCTATGGTTCTGACAAAAATGAAGG
AAATTGCAGAAGCCTACCTTGGGAAGGTGAGGTTGGTTTTTTAGTATGGGGTGCATTCCG
GAGCAGTTAAAAGCCCGATGACTCCCGGGGGCACTGGCACCTGGCGAGGGAGGGGAACAG
ATGGGGCTCAGCTCAGGGTTAAGACCACGTGCCCAACAGTGCCCCAGGCTCTCTAGGTAG
ATGGGTCTGTCAACACCAGAAACCAGGGAATCTTGACAATTACACAGTCATTTACATTTT
GGGGGGGGGGTGCTCCAGCTGTTCTTTCACCAGCATTAATCCATTTGCTGGAGTTTGCAT
ATATGTAAGTATAATAGTTATCAATCTGTGGTCTTTTCTTTATTCCTAGACTGTTACCAA
TGCTGTGGTCACAGTGCCAGCTTACTTTAATGACTCTCAGCGTCAGGCTACCAAAGATGC
TGGAACTATTGCTGGTCTCAATGTACTTAGAATTATTAATGAGCCAACTGCTGCTGCTAT
TGCTTACGGCTTAGACAAAAAGGTATGTACCATTTGTGATGCAAGTCCAGATTATTTTAA
GATTAATTTGATCCATCACAAATTGAAATGAGATTGTTTTTAATGGCAGGTTGGAGCAGA
AAGAAACGTGCTCATCTTTGACCTGGGAGGTGGCACTTTTGATGTGTCAATCCTCACTAT
TGAGGATGGAATCTTTGAGGTCAAGTCTACAGCTGGAGACACCCACTTGGGTGGAGAAGA
TTTTGACAACCGAATGGTCAACCATTTTATTGCTGAGTTTAAGCGCAAGCATAAGAAGGA
CATCAGTGAGAACAAGAGAGCTGTAAGACGCCTCCGTACAGCTTGTGAACGTGCTAAGCG
TACCCTCTCTTCCAGCACCCAGGCCAGTATTGAGATCGATTCTCTCTATGAGGGAATCGA
CTTCTATACCTCCATTACCCGTGCCCGATTTGAAGAATTGAATGCTGACCTGTTCCGTGG
CACCCTGGACCCAGTAGAGAAAGCCCTTCGAGATGCCAAACTAGACAAGTCACAGATTCA
TGATATTGTCCTGGTTGGTGGTTCTACTCGTATCCCCAAGATTCAGAAGCTTCTCCAAGA
CTTCTTCAATGGAAAAGAACTGAATAAGAGCATCAACCCTGATGAAGCTGTTGCTTATGG
TGCAGGTAACAATGGTATCTCAATTAACCCTAAAGGCAGGCAGGCCCAAGGTGACTCGCT
GTGATGAGTGATTGTTAAACATTCGTAGTTTCCACCAAAAGCTTGGCTAATGATGGCAAC
ACCTTCCTTGGATGTCTGAGCGAGTGATAGTTAAAACAGGAGCTGTGTACTGGGTTTTCT
TTTAACTTCTTTTAACGTTAACTTTTTGTTTGCTAGCTGTCCAGGCAGCCATCTTGTCTG
GAGACAAGTCTGAGAATGTTCAAGATTTGCTGCTCTTGGATGTCACTCCTCTTTCCCTTG
GTATTGAAACTGCTGGTGGAGTCATGACCGTCCTCATCAAGCGTAATACCACCATTCCTA
CCAAGCAGACACAGACCTTCACTACCTATTCTGACAACCAGCCTGGTGTGCTTATTCAGG
TATGTTTCTGTACTAGTCTTGTTTGGCTTACTGATAACAGATAAAGGGAAGTCTTGACTG
ACTCGCTATGATGATGGATTCCAAAACCATTCGTAGTTTCCACCAGAAAGTCTTATGTTG
GCCAGTTCCTTCCTTGGATGTCTGAGCGACCATTCTTCCTAAGCAGGACCCTAGCACTGT
CACAGAGACCTGGAGTCCATTGCAGTAATTTGTTTTATTTCCTACCAAGGTTTATGAAGG
CGAGCGTGCCATGACAAAGGATAACAACCTGCTTGGCAAGTTTGAACTCACGGGCATACC
TCCTGCACCCCGAGGTGTTCCTCAGATTGAAGTCACTTTTGACATTGATGCCAATGGTAT
CCTCAATGTCTCTGCTGTGGACAAGAGTACGGGAAAAGAGAACAAGATTACTATCACTAA
TGACAAGGGTAAGGAGGCACTGTCATCTGGTCTTGACAGGGATCATCATGGTATTTCAAT
TGAGTTACTGGTGCCTAAGGGTGTCTAGCTAAGAGAAACTAGAGTTACACCTACGCAGGT
AATTTAAGGCTTTTACTTAGAGTTAATTTCTTTCCTAGGCCGTTTGAGCAAGGAAGACAT
TGAACGTATGGTCCAGGAAGCTGAGAAGTACAAAGCTGAAGATGAGAAGCAGAGGGACAA
GGTGTCATCCAAGAATTCACTTGAGTCCTATGCCTTTAACATGAAAGCAACTGTTGAAGA
TGAGAAACTTCAAGGCAAGATTAACGATGAGGACAAACAGAAGATTCTGGACAAGTGTAA
TGAAATTATCAACTGGCTTGATAAGAATCAGGTTTGTGTTTTTTTTTTCTTTCCCCCCCA
CTCAATGGAGGGGAAGGGGGTGGTAAACCAAGCTTGAGCTGGATTTCAGTATAGGGTCAC
AATGATGAATGGTCCACAACATTCGCGGTTTCCACCAGAATTCAAGGTGTTGGCAACTCC
TTCCTTGGATGTCTGAGTGACCCAAGATGTTAAGGGAAGAATAAGGCCCTATTTTAATGT
TGGTAGTGGCCCTCTTGTAAAGTATCAGATTGCGTCAGGGAGAAAGAAGGGTTATTAACA
TTAAAAGAACTTGTAGTAATTCCTTTTTCTCTTCCTCAGACTGCCGAGAAGGAAGAATTT
GAACATCAACAGAAAGAGCTGGAGAAAGTTTGCAACCCCATCATCACCAAGCTGTACCAG
AGTGCAGGAGGCATGCCAGGAGGAATGCCTGGGGGATTTCCTGGTGGTGGAGCTCCTCCC
TCTGGTGGTGCTTCCTCAGGGCCCACCATTGAAGAGGTTGATTAAGCCAACCAAGTGTAG
ATGTAGCATTGTTCCACACATTTAAAACATTTGAAGGACCTAAATTCGTAGCAAATTCTG
TGGCAGTGTTAAAAAGTTAAGCTGCTATAGTAAGTTACTGGGCATTCTCAATACTTGAAT
ATGGAACATATGCACAGGGGAAGGAAATAACATTGCACTTTATAAACACTGTATTGTAAG
TGGAAAATGCAATGTCTTAAATAAAACTATTTAAAATTGGCACCATACAATTGCTTTGAG
TCTTTAAATAACCTCCCAGGCCAGCTGGTGGGAGAAGTAGGCTTAGGTGATTATGTGAAT
CTTACTAACTTCCCCCCTTCCTCTTAAGCTTGAGTTAACAAGGGCTGGGTGGCAAGTTGC
CCTTCAGAGCATTGTGGATGGTACGTTTTGGAATTCAGAGCTTTGAGAAGGGGAGCGTGA
GAAATTGGATCTGGATCAAACTAACCTTAGTCCTTAGGCTGGAGAGGCAGAAAGCTGACT
TAATGGTGTTTTCTAAACTTATTCTGTGTGTAAGCCTGCCTAGGAGCAGAGGCTTTCCTG
AAGGGTTGTGCTAGATGAGTAAGAATTTAGAGATCAGAACCAAATAATGGGTAGTGAATG
TTAAGCTACATGGCAGAGGTATCTGAATGTCAATCCCTTGTATGAGCCACTGCCCTGTGG
GCTTCTATTTCTTCCTGAGTTAAGATTATTCAGAAGGTCGGGGATGGAGCTACGCTGCCA
CCTGGTTAATTAAGGTCCCAACAGTGAGTTGTGATAGACTAGGGGAGCAGGCTGTTACCT
GTCATTACGTACATGACAGATTTCAGTGGACTAGCTAATCTTAGCATATGCCAAAAAGCT
AATTCATGGAGGAGCTGCAGTTTTTCCCTTTGGTACTGAAGGTCTACTAATGTCTGGGTA
TCTCTGGGAATTTATAGCACGATTTGATATACTTCTCATTCCATATTTTCTCCAGGGTTA
CAAAAAATGACAAGTAGTACACACTTTTTTTGAAGGGTTTTACTCTTGTTGCCCAGGCTG
TAGTGCAATAGCACGATCTCATTGCAGTGGTGCACCCCCTGTCTCCTGGGTTCAAGGGAT
TCTCCTGCCTCAGCCTCCCAAGTAGCTGGGATTATAGCCATGCGCCACTACTCCTGGCTA
ATTTGTATTTTTTAGTAGAGATGGGGTTTCTCCATGTTGGTCAGGCTGGTCTCCCTACCT
CAGGTGATGCACCCGCCTCAGCCTCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1073, 1809..2018, 2340..2545, 2869..3021, 3109..3664, 3876..4078, 4309..4507, 4658..4890, 5199..5625
1814..2018, 2340..2545, 2869..3021, 3109..3664, 3876..4078, 4309..4507, 4658..4890, 5199..5381
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved