Pan_troglodytes Locus JOSD3
snOPY snoRNA Orthological Gene Database
Pan_troglodytes JOSD3
Pan_troglodytes
JOSD3
11
SNORA40, SNORA18, SNORA8, SNORA1, SNORA32, SNORA25
7271..7396, 9339..9470, 10445..10583, 10811..10940, 11842..11962, 12293..12426
13736
AACATGGAGAAACCCCCGCCTCTACTAAAAATGCAAAAATTAGCTGGGCATGGTGGCGC
ACGCCTGTAATCTCAGCTACTGGGGAGACTGAGGCAGGAGAATCGTTTGAACCCGGGAAG
CAGATGTTGCGGTGAGCCAAGATCGCACCGTTGCACTCCAGCCTGGGCAACAAGAGCGAA
ACTCGGTCTCAAAAAAAAAAAAAAAAAAATTACTTTGGGAGAAAAAAACCCCACCAAAAC
TAAACTAGTTTACACTGTTTAATCTTAACTCAGGAACCGGTCAAGGAACTAATGGTGTGG
GGCAGGGGGGATGTAGGAGGAAACTTAGGAAAAACAAATCCTCCACAGGTCTCACTTGTG
ACATGTTAGCCAACTCCTGGGAGGCAGAAAGGGTGAGCTTACGAAACAGGTGCAAAAGTG
GGGAGGAGACCTGGGCGTGCTATGGAATAACACTGGCGTCCAACACAAAGGTTACACACT
TCGAGTCATGGTCAAAGGATGAGCCTTCTCCAATATTTTAACACACAAGGATTTCTGAAG
GCAGAAATAGACAAAGGATGACAAAACACTCAGGCACACATCCCACCCGTCACCCTCGCC
ACACACCCGGGACCAGGTTTAGAAAGCCAGGCTACAGCTCAGCAAACGCGAGACCACCGG
AAACGAACCGGGCTGAGAGGCTGTTTCCTCACAGTTCTCATCCACTCACAAGTGACCGCA
CGTTTTGTTTTTGTTATTTGCCGAAATGTTCTTGGCTATTCCACTCACCTAAACGGTCAC
GGTAGCAAAACACCAGAGTCCGGATCTTCGCCTAGGCCAACCCCGCCTCCTCAGAATACG
CGAGCTAGAGCTCCGCCCACGTTAGTCAGTCCTCCCTGCGCGGCGAGAAAAATGGCGCCC
CCACGTCGCGTCTCCTCCCACCGCTCGCCTTCTTCCCGGAAGCTAAGTTGTATCGCGAGA
TTTCGGCCTGACTATTACTTGGGCCACGGAAATAACCAACCCTTTTCTTCCGCACGGTTG
GAGGAGGTCGGCTGGTTATCGGGAGTTGGAGGGCTGAGGTCGGGAGGGTGGTGTGTACAG
AGCTCTAGGACTCACGCACCAGGCCAGTCGCGGGTTTTGGGCCGAGGCCTGGGTTACGAG
CAGCAAGTGCGCGGCTGGGGCCACTGCGAGGCCTTTTTAGGTAGGTTGCTAAGAGGGCGA
GGCCGTCCGGGCCTGGCGGGCGGGGGGAGGCGTTGCATATCTGGGGTTTCCCGGGGCCCC
TTCGTTGGTCCGGAGGATCGAGACTCCGAAGTCGGGCCGAGAGGGTGAAGGGATCACGGC
CGCAGGCCACTCCGCGCCACGCGGCTGGTATGAGTCCCACACAAACGTGGTTGTAGTGTG
GACGGGCTTCATTATATCTTGAGATGGAGGTGTTAAATCGTGTTGCGGACAAGTTTAACC
TTATTACGTGATTTAAATGATTTAACCTTCGTATGTGAGGTACCCATTACTCGGCGCCGG
TTTTCTGCAGGTTAGGCGCTGCCGGGTGAGAGGCGCTGGTGGTCACAGCGTTAGCTCCGG
GTAAAGCGCCGCTCTCTGCCCACGTGGCCTCTAAGAATTGCAGAATCCCCACGGAGGCAT
CGACACCCAAGTAGGAGTGTCTTCTAAACACTTCGAAAAAGTGATTATTGAGCTAGCTTT
ATTTTGATAATCCCTACTTTTAAAAAAAATTAACCACAGGTATACCATTAAAGCATGGGG
GCAAATTTTTGTTGAATTCCGTTTTTGAGCATTCGATATTTAATGACTTTGTAGAATCTT
GTACTTAAAAAAACTAATAAGACCTTGTACCAGGAAAATACCACAGGGGGCATTTAACAA
ATCTGAGCTCTTGGTGACCTTATCGTTTCATATTTTAAATATTCATATTTAAATATTTTG
CTAGTTCATCCTAGGATTTATATGTAATGACTCATGTCAGGTCCCAAGAAGCTACAGAAT
GAGACAAGAGATTGACTAAGGCATGTACAATAATGAAATAAGTAGTTATCTTTAATTTTT
GTTGCCATGCCTATTTTTCTTTTTTCCCTGAGACAGGGTCTTGCTCTGTCGTCCAGGCTG
GAGTGCAGTGGTGCAATCTTGGCTAACAGCAACCTCCACCGCGGCTCAAGCGACCCTCCC
GAGTGGCTGGGAGAAAAGGCACGGGCCAACACACCTAGCCAGTATTTTAAGAATTTTTCG
TAGAGACAAGGGTCTCCTTGTGTTGCTGAGGCTCACTACATACAAGCTCCACCTCCCAGG
CTCAGGTATTCCACCTACCCCAGCCTCCTGACCACAGGCGCGCGCCACTATTCTGGCTAA
TTTCTGTATTTTTTGTAGAGACGGAGTTTCACCACGTTGCCCAGGATGGTCTTGAGCTCC
TGGGCTCAAGCGATCCGCCCGCCTCGACCTCCCAAAGTACTGTGTTACACAGGCCTGAGC
CGCCCAGACCAACCTGTTTTTCTTTTTTCTTTTAGCTCACAAGAAGGAATCTTTTTCTTT
TTCTTTTTCTTTTTTTTTTTGGTATGTTGTATACTCTCTACCATGGGGATGAAGACACAA
GAATTATGATAGTTCATTGAAAAAGGTTGAGAATTCAGAACTTGTCAGTTTCCACCAATA
ATGGCAAAGATACAATATGACAAAGTTCAGTTGCTTAAATGAATCTAGGAATGAAGAATC
TAGGAATTATAATGGAGAGGTGATTAGGAGTTTAAAATGGTTTATTGATTGGAGATCCTT
TTCCTGGTTTATATAGGGCACACTTTGCTTTAGGAATTCCCCCTTTGATCTTGGAAAACG
GCTTTTAATTGTACATTAATACTGTATTGGTAATTGTACGTTAAAATATGTGGCTAATGA
TAAAACTACATTTTTTACTTATATTGAAAGATGCTTTTGTTGGAAGGGACGGTACTTTTT
TGGAATCTTGTTGCATTGAATACATTTAGAGGGTAACAACTGAAAGAACCTGTGAATAGA
ATTTCTGGATTTCTTTTTAAAGAAACTGATCTGAAATGGATAAGAAGCTTAACCTTGGTA
AATGATTTCGCCTGAAATCATTGGCATAGTCTGACCATGTTCAACACTGTAGTAGATACT
GTCAATATTTAGGGAAGCTTTGTCATATTTACTAAATTTCATAATTTCAGAAAACTGTTT
AAAACAAAGAGCAATTGATGGATAAATCAGGAATAGATTCTCTTGACCATGTGACATCTG
ATGCTGTGGAACTTGCAAATCGAAGGTGAGTGGATTCAATCATGTTTATTGTATCTGAAT
TACGAGAAACTATTGTATATAATGAGTGACAGTAAAGATAATTTTCAGGAATTGGGAAAG
AAGGAAAACTAGATTTCACTGACCTTCCAAGTTTATCTAGTTACATAGATTGATATAATA
GCATTGCAAATACTTTAAATTCAAAATGTGAATATATTATGGGACACATTCGTCGAGAAA
AAATGTATTCTTTGGGTCATATTAGCATCTCTTCCAGACTACATCCTCCGGTTCGGTAGG
CTGTGTTTGTTTTACTCAGACGCTCTTAGCAGTGAACCGAACCATACAGCCTTTTGGAGC
TCATACATTGTCTTGAAAGATACATAGTTTTTTTGTAAGCTGAGCATAGTGGTGCATGCC
ATTAGTCCTAGCTAGCTACTTGGGAGGCTGAGGCAGGAGCATCCCTGGAGTTTCCAGGAG
TTTGAGGTTGCAGTGAGCTGTGATTGCACCACTGCACTCCAGTCTGGGTGACAGCAAGAC
GATGTCTACAAAACTCTTTAATAAGAGCTGTAGCATTATGGGCTATTTAAATAGGATGAT
CAGCAGAAAGGCTAGCTGGTTCTGAGCCCATCCTTTAAAAAATTTTTAATTTTGGGCATG
TTTTCTGAGTTGGTCTTGGAAGAAATGTACATTTAGGACTGGGTATTAATGGTAATAAGC
AGTAAGAAAAGAAGATGAAATTAATTTTTTTTCCATTTTTCTAGAGATAACTCTTCTGAT
AGCAGCTTATTTAAAACTCAGTGTATCCCTTACTCACCTAAAGGGGAGAAAAGAAACCCC
ATTCGAAAATTTGTTCATACACCTGAAAGTGTTCACGCAAGTGATTCAAGTGACTCATCT
TTTGAACCAATACCATTGACTATAAAAGCTATTTTTGAAAGATTCAAGAACAGGAAAAAG
AGATATAAAAAAAAGAAAAAGAGGAGGTACCAGCCAACAGGAAGACCACGGGGAAGACCA
GAAGGAAGGAGAAATCCTATATACTCACTAATAGATAAGAAGAAACAATTTAGAAGCAGA
GGATCTGGCTTCCCATTTTTAGAATCAGAGAATGAAAAAAACGCACCTTGGAGAAAAATT
TTAACGTTTGAGGTGAGTCAGCATTTTACATACATGGCTACACATAACTCAAGATGCCCA
AAATGATTTGTTGGCCAATTTAGAATTGTCTCAGATATACTGGGAACAGACTGTCTGCAA
TTTTGATACTCTTCTATACTGACTTATCCCTAAAGTCCACCCTATCCTTCAACTGAATCT
TGACTTGTATCTCTTAATATAACTACACTTTGCCATATTTAAAAGATAGTGCTCCAAGGC
TCTTTGTATAAAATCCTTTGATCTTATCCCATCTCAGGTCTTTAAACACAACCCTAAAAC
TCAGTGGGGATAATAAAAGCTCACATAACTTGCAATTACTTTTGCAGTAACCTAAACTAA
AACCACACATGCCTTATGTTCAGTGGATATATTCTTAAGGCCTAGATGTTTCTAAGCCAA
TTATCTGAAAAATACGATAATACTTAGTACTAGACTTTTTTAAATATTTGAGAGTTGTAT
GTTGAATGAATTCAGAATTAATTTATGATCCCTTGCCAGAACCTGAAATTTTATTTGGGA
GGATTAATACATGTTAATCTCTTCAGTTAATCTCTTAAGTTTAAGGTGATTATAGTAAAC
ATTAGAAATCTTATTCCTGTTTTTACATTTTAAAATGCCTTTAGTAAGTCCCAGACATGA
CAAGATATGTACTTCACTTTTCCTTGGTACCAGCTTAGGTAAATTCATAATTGTAATGTG
AATTTTAATAATCAGCATTTGATAAGTCCACAAGTGGGGAGTAGTTAAGATAGCAAATTC
AGAGTCTTTGGTAAGGGGGGGCATTGCCCTTTTTGAACATAGGCACCTGCTGGGTCTTAA
AAATAAAATCTCGACATACTTATGGTGTTTTTAATATATAGCAAGCTGTTGCAAGAGGAT
TTTTTAACTATATTGAAAAACTGAAGTATGAACACCACCTGAAAGAATCATTGAAGCAAA
TGAATGTTGGTGAAGATTTAGAAAATGAAGATTTTGATAGTCGTAGATACAAATTTTTGG
ATGATGATGGATCCATTTCTCCTATTGAGGAGTCAACGTAAGTGGAATCATATGAAATAC
TTTGGTAATAGGTTATAAATTAAATTTTTATGTTAATTGCTTCATATTTTGCCTTTAATA
TAGTTATACTTAAATAATGAACAAAGATACAGAGTATGACAATTGCGATTATTACAGTTG
AGCCAAGCTTGGCACACAGTTCATCTAGAATTCTCTAGAACACAAAAGTCTCAAATTTTG
TGTTTGCTTTGACTAGTATTGCAGTTTCAGTTATATTTCAGAGTGGAATATACAACTAAT
TAGGTCATCGAAGATTCTGTCATCTCGATGATAAATTTTAATATTACAGAGCAGAGGATG
AGGATGCAACACATCTTGAAGATAACGAATGTGATATCAAATTGGCAGTAAGTGACTTAT
TTTTTTCCTATTCCATTTTGGGAAGGCAGGAGTTGGTTGGTACAGAAGGAATTATATTTA
GTTTTTCTCTTACACTTCATTTAACTTTTGAAAAGCTCTATAAGTTTACTGCAGGAAATG
CAAGAAGGAAAATAATTTTTTAGAGACTTGATAAAGAACATGGGGTTTTCAGTACTATTT
TTAATAAGTAGCATTCTGATACGTATTATTGCTAGTTAGGATGTCAAATGAAAAAATAAG
CAGATGTTAATTTGGATTTTTAACATCTACATGTAGTCTCTAGGTTATCTGAAGTAATCC
AGGGCATTCAGCTATATGTAATTACTAAACCATTTGAGTTATTGCTTAATCCATGATTTT
TTGTTTGTTTTATGCAGGGGGATAGTTTCATAGTAAGTTCTGAATTCCCTGTAAGACTGA
GTGTATACTTAGAAGAAGAGGATATTACTGAAGAAGCTGCTTTGTCTAAAAAGAGAGCTA
CAAAAGCCAAAAATACTGGACAGAGAGGCCTGAAAATGTGACAGGATCATGAATGTCAAA
GGTGAAGCATATAGAAAAAACGACTTCATAGAAATGAATAAAGATAAATGTGGATATATG
TACCAGTCTGGTGGTGAAGAAATTCTGAAACCCAGAACTTTATAACAAGAAAAAAATTTT
TTAACCCTGTGAAGAAGTTTGTGAAAGAAACTTGTGAAGTAGTAATAATTAGAAAAAAAA
CCATTAAAACACCAGAGAAAATACATAGAAAAATTTGAGAAATTGTCATTTGATTTCTGA
ATAAGAGCTTACAGGTGTCCTGTGAGTATTGAAACAATGAAATGTAGTGATTTTAATTTT
GAAAAGAAAATCTTAAGGAAAGTAACTTGACACCCAACCATCTTGAAGAGGGTATTTGAA
ATGCTGTAATTTTATCCCAGCTTTGTTCAGCCATGACAAAAGTGACCTGTCAGATGCTTA
GTATTGTAATAACCTCATTTCCCTTTCCAAATTTAGAGTATCTTTAATACTATTTTTTTT
AGACAGAGTCTCAATCTGTCACCCAGGCTGTAGTGCAATGGCTGCAGTCTTGGCTTACTG
CAACCTCCATCTCCCGGGTTCAAGCGATTCTGCCTCAGCCTCCTTAGTAGCTGGGATTAC
AGGCGTTAGCCAGCACACCCAGCTAGTTTTTGTATTTTTAGTAGAGACAGGCTTTCACCA
TGGTCTCGAACTCCTGACCTCAGGCGATCCGCCTGCCTTGGCCTCCCAAAATGCTGGGAT
TATAGGCGTGAGCCATGGCACCTGGCCTAATACTACTTTTAACTACCATTTTCACTTTTT
ATTAGTTCAAGAAAAGGCATACACATTTATTCAACATGTATACATGGGGAGAACCAGTCA
TTACCCTGATGTTCATTATTTTGATCACCACGATAGAGCTGACTACTCTGCTATGTAGTG
CATTTTGGGACTGCACTTATGTATGTTTTTGTTTAACGTGGACAAAGACTTATAGATAGG
TGCAAAAAATAAATCCTCTTTTGCAACCCAGAACTCATTGTTCAGTATGAGTTTTGATAC
ATATAAGAAGGGATATTATGATACCTGAGACAGTTGATTGATGGGAGTATTGATAGCCAT
AAAGGTTGGTTCCCGGCCAGGTGCAATGCGTCAAGCCTGCAATCCCCACACCAAGGTGGG
AGTATTGCTTGAAACCAGGAGTTCAAGACCAGCCTAGGCAAGAAAGTAAGAAACACCTCA
TCTCCACAAAAATTTAAAAATTAGCTGGGTACTGGGGCATGTGCCTGTAGTTGGAGTTAC
TCAGAAAGGCGGGAGGCTGAGGCAGAGTTGGAGGCTGCACTGAGCTTTGATGGCACCACT
GTACTCCAGCCTGAGTAACACAGACAGACCCTGTCTCTTAAGAAAAAAAGGTTGATTCTA
GGCCTGTAGAATAGATAAACAGCATGGGATATGAGGGAAATCCTCAGCAGTATTAATTTT
GCATTCCAATTTCATGTTGACGATATACACAATGGCTTTTTGTTTTAAAGGCTTTTATCT
TGAGAACATGGTGTCTGGAGTTAAAGGTATGTCTCAATTTGAGTTTTCACATCATATTTG
TTTATGTGTAGGAAACAGTATGTTGTCAAGAGCAAGCAAGTTTCATTTTATTCAGAGACA
TTTCTACCATGCTTTTAATTCCCATTTATACTGATTTCTGAAAAGAAGAATCCTAGATTC
ACACATTTTATAGTGATGTGTCAGATTCATTTTAGTTGCAAGCATTAGAGGGTCCCGAAT
TTGTTAGTTTGTAGCAATAATCAGAATTTCGATTTCCTACTTGAAGCCTACAGCATTATT
TTGAATTAATGCACAATCTAAAATGAGGTAGAGGATTTTATGGTTTAATGCAAAATATAG
TATAATAAAAGATGATTACACAGGTCATAAGAATTCATAAATTTGAATGATGTAGAGTTT
GATTAAAAGTTATATAATGCCAAAGTCGTAACTTACAGGCACATTATATTCCTGTATTTT
ATAATGGATGACAACTAATTTTGAGCCAAGAATTAAAATTTGCTGAAATCTTCGAATTGG
GAAAACAGCATCCTCTGTTGCAATATTGAAGTTCATAACAACAGTTAGACTTTAAACTTA
AATCTTAAGTTTAAATCTTTTTCCTTTGGTTCATGTAAAGGAGCTACTTGATGTTACTTT
TTATTTATCATTCCTCTGGCTCCTAAGCACAATGTGATTATGAAATTATTGTTTTTGTGA
TTAACGTAGTAGGAAGTTTCTGCAGTTTGCAATATTGTAAGAGCATATTGCAGTTTCTGC
TCATAATTTCTTTCCTATGGAGTGTTAGACTTTGTTATTTATGTGTATAAATACTAGCTG
GACACAGTGGTGCCTGTGGTCCCCAGCTACTCTGGAGGCTAAGGCAGGAGAAACACTTGA
GCCCAGGAGTTCGAGGCTACAGTGAGATGTGATCCAGCCACANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNCTCAAGTGATTCAGCAAGAATCACACGATTTTTAAAAGACATGGCAGATC
CTGTGTCTTTAAAAAAAAATCAAAACCTTGTAAATAGTGGTTGAGGTCTATCCCGATGGG
GCTTTTCCTGTAGCCTGCACGTCGTTGGAAACGCCTCATAGAGTAACTCTGTGGTTTTAC
TTTACTCACAGGACTATTGTTAGATCTGTGGGAAGGAATTACAAGACAGTTGCTAAAAGT
TTGAAAAAGACGGTTGCTAAACGTTATGAAAAACCAGATAATCTACTTTTTTACCTTAGG
TATTGGCATACTCCACACATCTGTACCATTCTTGAGTGATCGCTTAGGTAAGTTTTAATT
GGTGACAGTATAATCTTTTGGGAAATAGTGATTACAGTTCCGATGATGAATTTAACTGTT
CAACTGCTGAATGATAACGGGCATGAACTAAAACTTAATTCTGACAGAGCTGGATATGGC
TGTATAATAAACTGGATCTTAAATTTATACTTGGGTTTTAGTTTTAATAACTGGAAATGT
ATCCTTTCTAAATCTTTAATTGGTACTTTCTATAGGAATGAATGTGATTTGAACTCATTC
ATGTTGAGAGGTAAGTAAAATATTTAACTTATAATAATCAAGGACTCAAAAGATGAAAAA
TAGAAATTACACCATCCCAGTATTTCAGGTATAACACAGAATTAGTAAGATACTGGCAAA
AATATTACAATGTATATATTTGTATAGAGAAGGAAAATGAAGAGACTGCATGTCTATACC
TACCAAACGAAACTACCTGTGTTCTTTGCATCATTATTCAACTGGCAGTTACACATATTT
CATCCTAAAGTCACGTAAACCTGTGTGGATATGTGGAATCAATAGGGATATGAATTAAAT
AAAAAGAATTTTGTGTAACTGGCAGTTTGAGCAACAATGAGCTTGACCAGTTTGTAGTCT
GATCTGTTAAGTTACATGTATATATTCCATCTTTAAGTTTTATAGAGAGACTGGGCAAAG
ATTAGGCAAAGACTAGAGTTGTAGCTTAAAATGTAGTTAATGTAGCTTCCTTATTACAGT
GACAATTAGGAAAAAAGCTCAAATTATTGTACTTGTTAAAGGAACTTGAATTTGAGAGGT
TTGTGAAAGCATTTCTCAGCAATATTGCAAATTTGGGAATACGAGTTGTATAGTTCAGTC
ATAATTGCACTGCATGGTATCTGCACTCAGCAGTTTACACCTGCTAGGGTGTTCAAAGGT
CAGTGCTATAGAAATTCAGTATCTGGCATCGTTGGTTTTCTTGGCTTTGTGCTTGTTAAA
CCTGGTATTTCTACTGATACAGTATTTGTGTAGGTTTCTCAGAGTGTTCAGTTTGATATA
CTCTAAAATAGTAAGCAATGCTTTTTTTTCCAAGGTGTCAAATTGAGAACCAGGCAGATC
CCCACCACCTACAGTAAAAAGGTAAGATTCTCTGTTTCTATTGATTCTGCTTGTTTCCCT
CTATCAGTAGCACTGCACGCATAACAAGAACTTCGTACAAATACACTACTGAGCTTTAAA
GACTTTTACAATGCCTCATTCTAGAGAATGGGCACTGTTGATCATGGTGTCCAAAAATAG
TTAATGTGGCTAAATTGAGACAGGTTATGCTTCCATCACAGTATGCATATTGCAGTGGTG
ACAATGAGACCTGTAACATTTTGCCATGTTTATGAGTAAAAATGTAGGAGAAAAATGTTG
ACTTTTCAATATTAGAAATAACATTTAATAAGGAATTTTCAGCTCTTATAGGACCACTTT
TTTTGTATGCTGTATATTGACTGAAACATTGTAATGTGGTACATGACTGTGTCTTGGATC
AGGTGTCAAAATATAACTGTACTTTGTACAATTCAAATTCTAGGACCCTAAAGTAAATTG
GTTGAAGAAATTAGATCCCAAAGATTCTTGGTAAGTTAATTCATTACTTAAAAGGCCATG
CAGGTTATTTTGTTGAATACTAGCTTTTCTCCAAACGTTATTTTAGGTTATTTATTTATC
TAGTAATGCTATTGCAACATCTATCACCACTTAGGAGTAAAAAAAAGACTAGACTTACGT
TATTATGTGTTTAAACTTCATTATTAACGATGTTATGATGATGGGCGAAATGTTCAACTG
CTCTGAAGGGGCTGAATGAAAATGGCCTTTCTGAACATCCATTTACATTAAATATTGCAT
TGTATTTCAGAAGATTATAAAAGCCCAAAGGTAAAAGTTACCAGAAACATGATCATAGAG
CAAATTCGGATATGAATGGGCATGGGATCATTGATTTTTAAAAATACCTATTAGTTTAAA
TAGCTATTTTAAGCATGGAATTTTCAATACCTTACTTGGGGTGCCGGGTTTCAGGATACT
TTGGAACCTAAGCAACCTCATTCTTGAAAGATAGATTTCTGTACTTAATAGTAAATATAA
ATTTGAAATACACATTTTTCCATAGGTGAATTTTGAAGTCTTCATCAGTATATCCATATT
AAAACGAGATGACAGAAGCCAAAGTAATTATGGCAAGTAATGGTTTTTATCTTAACTATA
AGTTATTTGCTCAAGGGTGTAATGGTCATTACCAAGGCTTTTAGAATGCAGTTTCTCATT
TGCTGTGGACATGACCATAAAAAAATTTCCCAGTAGGTTTTCTATCTGCTACTTTGCTAG
CAATCAGCTTATTGGGAACAGTTGATTAACTGTAATAGAAATGCAATACAAATAAAATGT
GAACCACGTGATTTTTCTTTAAAATCAGTGAGATTTGAAAATTCTCCTAGATCTCTTGAA
TCATGCAAATTTGTTTTGCCTTTATATTGTAACCCTTGTGGGTTGCTAATAACCAAGCAG
TTTGTAGTAGAGTTAACTCAGGCTCGTTCTAGGGACTCATTCATGTTCACTCACTGTACA
CTCATCTCTGGAAATGTAAAATTTACTTTTATACTATTGTTATGTAGGGCTGACAGGACA
ACTGGATCAGTTTCATTAAAAAGGTATGTATGCATTAGAAAAGACATTTGTATGGGTCAT
TTCAAAGAGGGCTCATGAGGCTGTGAAACCCAGAGCTCTTGACGCTGTGACCAAAGATGG
AAGTTCTCTATAGGAAGCCATAGCACTCCTAATGTTTGGTGCTATGTTTTCCTGAGGAGA
TATAAAACGTAATAATCCATGATTGTTGCCATGTGAGAGTTTTAAAGGTTAATCAAAATT
TCTCTTCTTCAGGGCAAACTTGAAGATAAATCTTTTGACTCCAGCTCTTTAGAGGATCTA
AAGTGACCTTGATGGACAGTGGAAGAAATCACAACATGGAATTCCTCGAATAACAATTTA
TTGACTTTAAATAATTTTGTCTAATGCTACATATACACAATTAAAAAACCTTTACACTAT
TTCTAGAAAGTCAGCATGTATTTTTGGCTCGAAGTTTCTCTAGTGTTTTCTGTGGAAGGA
ATAAAAATTTGAGTTTCAGTTGTGTACTTCATGCTTGAAAAATTAAGTCCTTCCTCCTCA
GTTATACTCACCTTATGGAATTCTTTTGCCCTTGCTCTGTTTTGGGCATAAGCTTCTTGT
TTTGTTTTTTCTTCCTTTTGTTGTTTCACTTCAGCTAGTTGATTGTATAACCTGTAAAGA
ATTTATATAGAATTAGAGACAAACACTGCAAAAAGTGAATCACTAAAAAAAAAAAAAATT
AACCCTACCTTAGACCCCTTTGGTGCCTTAGAGCCTGTGTAGTCTTTCTGTCTTCAGGAA
AAGATGCTGTGACTTTATTCACGCCCTTTAGATGACTCACAGATGAACCTGAGGAAAGAA
AAGTGAAATCAAGTTGTAAACACAAGGCTTTAAACATTTCAGGAAGTTGGTTGAAGATTT
TAAAAATTCAACATACTTATAGATGGTTTCTCTTTAACTGTTTTGATATGAGAATTTTCA
GAGACATGAATTTTATTCCTTATTTCTTTCTGCCTCTGGTGGGATCTCTCCATAAATGAT
TTTTTCCTCTTTATAAATGCTTCTTGTAAGCTCCCTGTTATAGGTGTAAGCCTGCGAGGG
GTTTCTGCTGGGGGGAAAAGAAATTTATGACGGAAATAGGCAAAGTATCTACTTTCCATT
AGAAGTGTGGAGGCCGTCCAAGGCTTACCTGTAGATGCTGTCCTTGGTTTTTCTATGGAA
AGTTCTGATACAGCTGGATAATCTGAGGCTTCTGTTGCTGATACAAGAGGCAGAAACTCA
CTCACCTAATGGCAAGAAAGTTGCATGTTTTACTCAACTTTTTTTAAACGCTTTAAACAG
GTCTTGCTTTGTTGTCAGATTAGAGTGCAGCGGCATGATCACAGCTCACTGCAGCCTCAA
TCTTAGCTGGGTCTACAGAGACCCGCCACCATGCCTGATTTTTGTATTTTTTATAGGGAT
TGGGTTTTGCCTTGTTGCCCAGGCTGGCCTTGAACTGGGCTCAGGCTCCACTGCCCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1179, 3170..3264, 4004..4391, 5261..5436, 5749..5806, 6197..6360, 7850..7885, 9539..9586, 9815..9849, 10653..10700, 11143..11189, 11725..12736
3197..3264, 4004..4391, 5261..5436, 5749..5806, 6197..6337
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved