Pan_troglodytes Locus RPLP2
snOPY snoRNA Orthological Gene Database
Pan_troglodytes RPLP2
Pan_troglodytes
RPLP2
11
SNORA52
2707..2840
4917
ttcctggtgctcgcccgggatattggcagggttggctccttctcatctctcagctcgag
ctttctcaggctgcccagaggaccaagtctccctctgtccctgtccttcggatcgcctcc
ttattcacctcctgcgtcctcgcacaagaactcaagtccttaggaggcagggccaaccct
gttccctcccaggacccgagaatgtagcagggtccctgaggtgctgatgtccacatggac
accgaggtcagttctgggccaaagcggccagcgcaggggctgaccactcagagctcactc
ctcccaggggtgagcgggcgacgctgcctcacgtcattgtcctgccctccaaggctcgcg
ctccctctgacaggatgccctgacaccgcagtgcgggggcggcctcccagatagggccac
agtcgctaagtccgaggcggctggctcacctcactgagcccggctggacgtgggaccacc
ggtcgccgcggccagggaaccaccaaggagtcaaggcgagcctacagccagcagcttctg
cccgggcccaccggccgttccgcgtaggcccgcggcgcaggccacttccggcagcggtgc
accacgggacttgcagttcgctggcaaaggttgagtcccgggcgtggcggccgcgctcca
tgttggaagctgtaggcgccgcgtggcatgctgggggtgctaggtaccgaaggcagatgc
cgtccctttggactcgcttcgtccatcgcccccacgagtttcggtggcccttcgccccac
gctataagagcagtcacttccggaactgctgcccttcgcctttgccgcgaaaactgcctg
acgggggctgggaagggggagggggaaggagtcaacagcgtcttccccgtcgtcattggc
tgagcgcctcgtgacgtcactctgaggcgcctcatgcggcgccgcgcacgggtcccagag
gcttctgggtagcggtttacccccgccccttgcgtcggcgcCTTCCTTTTCCTCCCTGAC
GCCACCGAGGTCGCACGCGTGAGGCTTCTCCGCCGCTGCCGCAGACGCCGCCGCgtgagt
gtggtgaccgggcccggggtgccggctggggacgcggagtccgtggggatgcggggtggg
cggcggggtatttctgggacggaggcctacgggccgagccacgcgcggcctcgcccggcg
gccccgggatgggccggcaggaggccgccggggtaactccgccgtcgcgtcctctccgcc
cgcctcagGATGCGCTACGTCGCCTCCTACCTGCTGGCTGCCCTAGGGGGCAACTCCTCC
CCCAGCGCCAAGGACATCAAGAAGATCTTGGACAGCGTGGGTATCGAGGCGGACGACGAC
CGGCTCAACAAGgtagcggccgcccttgccccgcagccgccgtggggccccagtgtccca
tacaggcgattcttctgcctgatccggccacatgctggagggttcggggagaggctagtt
tcagtctagttggcgatttcttggatagagaagtaagccgggcggaggtcgggcgcggtg
gctcacgcctgtagtcccagtactttgggaggacgaggcaggcggatcatctgaggtcag
gggttcgagaccagcctggtaaacatgtcgaaaccccatccctactaaaaatacaaaaat
tagccgggcgtggtggtgggtgcctgtagtccccctacttgggaggctgaggcaggagaa
tcgctcgaacccgggagatggaggttgcactgatcgtgccactgcactccagtctgggcg
gcagaaggagaccctgtctcaaaaggaaaaaaaaaaaaaaaaagcagtgtgggtacgagg
caaaatcgtgattaacaagctttggaagtttaataccagtgagctgcgtaagattgcttt
aaaaaaaaaaaaagcagtcctggtgcatggctcacccagctttgggaggccatggcgagt
ggattattggagccttgaagttcgagactagtctggcaaacattgcaagacccggtctcc
acaaaaaaaaaaaaaaatagttggaggcagttgtgcacatctgtagtctcacctactcat
gaggctgatgcgggaaaatcatttgagcctgaaaggtcaaggctgcactgagtagtgatt
gtgccactgcagtctgacaaaaccaggcctcgtctctaaaatacaataaaaaattaccca
ggcttggttgctcatgcctgtagtcccaaactgaggtgggaaagtcgcttgaccccggga
ggtcaaggctgcagtgaaatcccaccactgcactccagcctgaagtcaaagtcaatttca
ttgccagcttattttgcccgtgttgaagatacctatgagtagtaaacataagtagtgaga
tgccgtgtgtccttttgtcagtcctaagtctaagaaagctagtgtccacttatgtttata
tcacttcccaagtgaggctggtggctccctttgggcagtgcaggtctggaaacttcaggg
cctattcccatgtggggaacccagtcctgttgtgactggaagggagagggccagggatac
aatcgtacattcctgataacagccctgtgattgtctgcttcagGTTATCAGTGAGCTGAA
TGGAAAAAACATTGAAGACGTCATTGCCCAGGgtgagttgatgtggacgggctttcgttt
gtttttatggtccatcctaatccctgcgggtccatctgtggcctgccaggtttcgcttgt
ggactagagcaccttagaagcctcacacgaggagtgagcagggctccagtgggctcacgt
catgagcgcttctagacactctcaggagcagggcagcagggggcaccctgtgttctcagc
ggacgtttagctggccctgcctcttaagcctgactgctcctaaacctgaggccattcccc
aggatttctctgaagcttggtgtctggagaactgagttcacgtcagcagtccttaccaca
tgctttctgtgagggggttgggggcagggactgagggtgccagggatgtccacaggctcc
ttgcctctttgttgggcagatggttttttgttggcgtcagctgagctggtggaacttgtt
tggaagttgagctgttggggcagctgttcttgttttccatgcatgtgaccaggacagggc
cagctcagcaaacgggccaagccatgagcacagcgttgtggccagagatgtggatactgg
ggcagcgcactcattccctacctagttatgaacatgtctgtccagtggacctctcagggt
ggaggtggggaaagtgggcaggcaggcagtgtgggcctaattcctagaaggcaagtccct
ggataggaaaggtggggaagagaagtccccgttgaggagtggctcagggagggagtgttc
aggaagaacgggagacactggtatatggtgggtccagatatgttgggtgccgtgtgccat
ctctggtgccatctaacttacctgtggaacagcctcccaggctgggcagctgctcaggtc
tcacctctctgctttctgtagGTATTGGCAAGCTTGCCAGTGTACCTGCCGGTGGGGCTG
TAGCTGTCTCTGCTGCCCCAGGTTCTGCAGCCCCTGCTGCTGGTTCTGCCCCTGCTGCAG
gtaagtggtggcctggtgagtgggcaaggggctggggctcagacggtgttgctgcagtgg
ggtcttcatggggggactggcctggcacttgggcagtgctcaccatacctctcctctgtt
ccacagCAGAGGAGAAGAAAGATGAGAAGAAGGAGGAGTCTGAAGAGTCAGACGATGACA
TGGGATTTGGCCTTTTTGATTAAATTCCTGCTCCCCTGCAAATAAAGCTTTTTTACACAT
CTCTCAAGTATTCCATGAgcactttgtcaagggtagtttctgcccaggttctcatccaag
agggcaggtgtggagctgaagtgtgggcaacatggtattggggaagcgtttctggtgcaa
aatgagcatgaggaggggagtctgggcatcacagctgcctggggtcctttcctgtggcct
tgagcagtatcctagctcctgagtacaccccagaagaatgcgaacgggctgggcacagta
gctcgtgcccattatcccagcactttgggaggccgaggagggaagatcacttgaggccag
cagtttgggatcagcctgggcaaatagcaagaccccatctctaaaaaacaacctaacaag
gcgtggtgtgcacctgtagtcccaactatgagaagttgagatggaaggatcacttgccca
ggaggttgaagttaatagtgggccgtgatagtgccactgcactccagcctgagcagcaga
aaccctgtcttgaaaaaaaaggacagcagagaagctgatttcaaatggagtttgggtaat
cagggctctgtctttggggtggcttggtgcctggacttgcaaggacaggattggtagccc
ctgggctctacaaatggatgcaggaagtgagcccagcttgggggtggcagacgcccctgg
gtttccctgcagggttcatggctccgccataatgccctgagcaacttgggcaatcactgc
tcaggcttgtttttctgccgatcacagcccacccctgccttactgggcagatgtgctcag
ggcttgtgggaagtgaccacagggctcactgaactaggtcctttggggatgggcctgccc
tcccccgacaggctctgtcctggaatacagggctaaggacagaggccatcaccctcccct
cccagcctctctgccctcctggccttactccgtacgcagtctcccaggcctcagggtctt
tgcccgccaacgtaggcacccagaagatggtctgccactcccaccctaggcttgaggt
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1073, 1268..1391, 2623..2671, 3561..3659, 3786..3917
1269..1391, 2623..2671, 3561..3659, 3786..3862
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved