Pan_troglodytes Locus XR_023730.1
snOPY snoRNA Orthological Gene Database
Pan_troglodytes XR_023730.1
Pan_troglodytes
XR_023730.1
2b
SNORD51, SNORA41
3285..3359, 3636..3767
5347
GCAGCCTTAAGTCGGTGAAAACAAGAATATTCCGCAAAACAAAAATAACTTGTTTATTC
ATCAAAAACAGTTAACGTTACACTTCTATACCGTCAATTCGTGTGTGAACAGAGTTGTGT
CTGATCCAAGACCTTACAGTTCAAGCATTAGATCCCAATAACCTGTAAACAACGTTTTGT
TATTTGCAATGCAACCCTGGGGTAACTTTTCAAAAGTCGTTTTTCTCAATTTCCCGTTAG
TTAAAGGAATAAAAAAACGCTGTCCAACGTGGTCAATGGACAAAACAAACAAGGACAACA
AACAGAGGCGTGAGCCATTGCTAACACAACAGCGACCAAACAATCATGCACTGTACCAGG
CGTGTAAAAATCTGGGGGGAAGGGCTCAGTCTTAAGGCCTAAGTCATCGGACACTGGTCC
TCTCCCGGGGAATAAAACGGCCTCCTCCTCTGAGAGGGAAATGTCCTGAATTTTCCCTGC
AGAGGGAAGGTCGCCTGCAAGCCTACATTCGGGCCAGCGTTCCCGAGGACCCCCTGATCC
TCATCTTTTCTGCTTCATCAGACCAGAGACCGTGGCTAAAAGCCCCCCATCTGCCGGCTC
TCAGGGGCTTCCGAGGCGGCGGGGCGGGAGGTGGCGCCCAGTCAAGGACAAGAGAAGACT
ACGTCGCGTGGGCCAAAGGAAACAGTCCCGTCAATAAATAAGCCTCTGGCCGACGCACCT
CACCCTTCCCATCCATACAAGACCTCACCTTCTCCCCGGAGCCGCGGAGGCTGTTCTGCT
AAACTGTCTGGACCACGACGACCCCCTCGGAGGCCGGGTCGCTTACTCAATATGGCGGCC
TCGGCTAACTCTGTCAGCCGGGCCTGGAGAACGGAAAGCCCGGAGGGACTAGAATCCTTG
CATTCGACAAGTTTGTCGGCAATTTCCGTCAGCCGACCAGAGGGCGGAGCTGAGGTCGGC
CCAGCCCGGAGGCGGGAAGGACAACTTGGACCCGCAGTTCCGCCGGAAGTGGCCCCAGCC
TCGAGGCCGGGCGTCTTCGGTCATCTCCGGCGCTTGTAGGGGTGGTTCCCGTCATCTTCG
GGAGCCGTGGAGGTACGAACTTAAGACATGCCTATTTTATTAATTTACTTCCAAACGCAA
CGAAAGGTCCATGGACAATTTGTGGGCCATTTAATTCAGGGCCCCCAATTCGTACGTGGA
GAAGTGGGAATGCTAACGTACTTTGACCTTTAACCTTCGGTCCGGCGCGGTGGAGGGAAA
CGCCTCCGTCTCTATATAAGGAATTTTCCGGTCTCTTCGGGCCCTTTTTCCTCTCTTCAG
CGTGGGGCGCCCACAACTTGCGCGCTCTCTTTCTGCTGCTCCCCAGCTCTCGGATACAGC
CGACACCATGGGTTTCGGAGACCTGAAAAGCCCTGCCGGCCTCCAGGTGCTCAACGATTA
CCTGGCGGACAAGAGCTACATCGAGGGGTGAGCGGACGGGCTGAGTCGGGGTGGCGGGGA
GGTTTCTCCGCCCGGGGCCGGGGCCACGTGGCGCAGCGTGTCGGCTGCCGCGGGAGGGAG
GGAGGCCGGGCCCCGGGGCCCTTTCGAGAGGGAAGGGAAAGCGCCCCGTTGCCGTTTCCC
AAGGCCCTCGTGTGGGGCGAGCCCGGCCTCCGGGGAGCGGTTCACTAGCAAAGAAAGGTT
AAAATGTGCTTTATTTACACTTAATTCAGCCAGGTGTTTTCGCATCGCTGCCCAGTTAAT
ACATGTTAAGCTGTAGATAGAGCAACGCTAGACGTTGCAGTATTTGAGGTCTACTAAGTG
GCAGACATTTCTCAGGATAGCGCGGTGACCCAAACATATGGTTTGATTTGAAGGAGCTAA
TAAGAAAAGAAAAGCATTAAAGCAACCCTACTGGGGTTAGTGCCCACTAATTAATGTGAT
GCATACAGCATTTATTATTTATTCGCTGGCGTTTGTTTTTCAAAGGTGTGTGTGAATGTT
TCTATGTCATTGGCAGGTATGTGCCATCACAAGCAGATGTGGCAGTATTTGAAGCCGTGT
CCAGCCCACCGCCTGCCGACTTGTGTCATGCCCTACGTTGGTATAATCACATCAAGTCTT
ACGAAAAGGAAAAGGCCAGGTAAAATCATCTTTGTATAGAGCTGAAGAATAAGACTGCTC
TCGAAGTTTATCAGGATGTTCACATGACAAAACTGGACCCAGGCTACTTTAGTTTTGTTG
GGATATTGTAAGCTAAATTTTTCTGTAACCTTAGAAGGCCAAGAGACTGAAGCCCTCCAT
TTTTTCACAGAACAGGTAGAACATGGACAGCAGCAATTCAACTTTTCCCCACACTGCCCT
GCCAATGTGCCTCGACCTTGACCTGGGGGGCCCACCTCTGGGGTGAGAGGGTGGCTCATT
CATTCAGTCCTTGGCCATTCTTCTGAAACTGCCAACAAGGGTGGAAGTTTGGGGAAGTGG
ACTCCAGTTCACTAAGAATGGAACTGAGCATACTTAATGAAATCTCAAACAGAAATGTTC
ATACTGAAAGAGTAAATCATAGTGAGTATTGAAAATAATGTCTCACATGGTACTAATGCT
TGTCGGGTGAGGAGTTGAACATATGACAGTGTTTACCTGGGCGCATGTGAAAGGGTAAAT
TATGATTGCAAAAGGGATCTAGTGATAAGTAGTGATTAAAACAAGTTATTTTGTATTTTC
TGGAAAAGGATGTTATACTAGCTCAATAGTGGTTGAATTTAAATGTTTTTCAAGCCTGCC
AGGAGTGAAGAAAGCTTTGGGCAAGTATGGTCCTGCCGATGTGGAAGACACTACAGGAAG
TGGAGCTACAGATAGTAAAGATGATGATGACATTGACCTCTTTGGATCTGATGATGAGGA
GGTATGGCGTCTTCTATAAAGAACATATCGGCCAGGCGCAGTGGCTTATGCCTGTAATCC
CAGCATGTTGGGAGGCTGAGGCGGGTGGATCACGAGGTCAGGAGTTGAAGACTAGCCTGG
CCAAGATGGTGAAACCCTGTCTGTACTAAAAATACAAAAAAATGTGGCAGGCATCTGTAA
TCCCAGCTACTCAGGGGGCTAAGGCAGAGAATTGCTTGAACCTAGGAAGCGGAGGTTGCA
GTGAGCCACTGCATCCAGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAAAAAAAAAAA
AAAAAAAAAGAATACATCGATCAGCAATTGTATCAATGTGGTTAAGCCAAATTGCCTGGA
TTTGAATCCTGGCTTTAATTTATATGCCTTTTTCAAATTCTGACTGGTTGCATGATGAAT
AAAATCAAATCACCATCTTTCGGCTGAGTTCGTGATGGATTTGCTTTTTTCTGATTAAGC
CAGTCTTTTTTGTGATGACCCCACTAGCTTTAAGCAGAGGAACAACCGGCTTTCTGAAGT
GGATTAATTTTTTTTCTTTATAGGAAAGTGAAGAAGCAAAGAGGCTAAGGGAAGAACGTC
TTGCACAATATGAATCAAAGAAAGCCAAAAGTAGGTCATTTGTTTTTAACTTCATTTCAT
GTTAATGTAAGTAATCTTTTTCAAAGCTTGACCTTGAAGTAATTTGCTCCACATTCCTTG
AATAGGTCAATATTTTAAAACCTCCTGTACAGGTTCTTCCACAGCTACTGGTCTGCAGCT
GTTCTTATGGTAGCAGTTGTGGCATTCCTCTGTGGGAAAGAAACTGTTAACACAAACCCC
TCTTTCTTAGCAAAACAGAAAGTGGGTATATATGTGTGACAGACACAAGATGTATCTGTA
GTTTTGTTTGGCTAAGGAGATAGTCTCAAAACAAATTGAGATGGATTTGTTTGTGTCTTG
GAGTAGGGTGAAAAAAATACAATTCATTATTTGAATAATGCTGTTTATTGTTTTTAGAAC
CTGCACTTGTTGCCAAGTCTTCCATCTTACTAGATGTGAAACCTTGGGATGATGAGACAG
ATATGGCGAAATTAGAGGAGTGCGTCAGAAGCATTCAAGCAGACGGCTTAGTCTGGGGCT
CATGTGAGTTTAGGCTTTGCCTTTTTTTTTGTTTGTTTGTTTTGAAACTAACATCTGGAA
TTTGCATACAGTTTCAACCTTTCTCTACAAGACTTTTCTAACTAGGATTTTTCTTAATGC
TCTTTTTAGCTAAACTAGTTCCAGTGGGATACGGAATTAAGAAACTTCAAATACAGTGTG
TAGTTGAAGATGATAAAGTTGGAACAGATATGCTGGAGGAGCAGATCACTGCTTTTGAGG
ACTATGTGCAGTCCATGGATGTGGCTGCTTTCAACAAGATCTAAAATCCATCCTGGATCA
TGGCATTTAAATAAAAAATTGAAAGATTACCTTTGGCTCTTGAGTATGTTACATAGGAGG
GTGGTGTATATATTCCTTTCATTTTGAGGGAAGGAATTAAATGAATATGTGATTCCTAAA
TACCACAAATTTGGTTTGGCATTGTTGTTAGAAAATTGCAGTGCAGGCCAGGTGTGGTGG
TTCATGCCTGTAATCCCAGCAGTTTGGGAGGCTGAAGTGGCTGGATCGAGACCAGGAGGC
TGATACCAGCCTGGGCCATGGGGAGAGATCCTGTCTCTACAAAAAATATAAAAATTAGCT
GGACATGGTAGTGCACCCCTGTATTCCCAGCTATTTGGGAGACTGAGGTGGGAGGATTTC
TTGAGCCCAGGAGGTTGAAACTGCAGTGAGCCAAGGTTGTGCGACTGCACTCCAGCCTGG
GTGCCAGAGCAAGGTCCTGTCAAAAGAAAAAAAATTGTAGTGCAACTTTACCCACTTGTG
ATGTCCTTAGCAGTGCCTGATGATGTGATTTGTTGTAACCTAGCATCTTCGCACTGGGAA
CTTGAAGATGTGAGATGTGTGACACTACTAGAAGACACCTAACCCAGAGGAGGGAGGGCT
TCCCAGAATTTGGCATGAATTACAACTACTTAACAGGTTACAAATTTAAAATAATGACTC
AATATGTAAAGAAACCATCTTTTAAGTGTTGGGAATGTGATTTGGAGTAGCACTGTGTCC
TGGGAGGGGGATTATATAGGTAACTGGTTCCCAGGCTTCCCAGAAAAACTTGACTTTGCT
GTGAAGATTCATAGGTGCTGCGTTGTAGAGGTGGAATATTTTACTTGGATTTGGAAATCT
GATTGGTTCTCATGCTGCAGGTAAATACTGGGATGAGGGCAGTATGTTGAGTAAAGAGAT
GGTCAAGTATTGGAAACCGTTTAATCTTAACAGGGAATTTGGGGTCTGGCTAACATTCGA
TACATTTTTTTTTAATAGTAGTTTTACAAAAGCAGTGCTTGGGAATTGCTGATCTCAAGT
GATCAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1466, 1996..2118, 2754..2880, 3443..3509, 3897..4022, 4149..4347
1387..1466, 1996..2118, 2754..2880, 3443..3509, 3897..4022, 4149..4300
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved