Pan_troglodytes Locus EIF4A2
snOPY snoRNA Orthological Gene Database
Pan_troglodytes EIF4A2
Pan_troglodytes
EIF4A2
3
SNORA63, SNORA63, SNORA4
3897..4019, 4873..5004, 5185..5322
8445
GAGATGGGGCTAATTGAAAACGTCTGGAGCTTAAAGACCCGTGCAGTTTACGCAGCAAG
GATATTATTGCTCTGAATTTCAATAAATCAACATTTCACTATATATCGGCAAAGTCTACA
GCCTTTAAAAAATGACCAATATAGACGGAATCAAAACCGATTTAGTCCCAAAGCGGCACA
GAGCTGTATCTGCCAAAGCGTCCATTTAAATTCGTGCGTTCCAAGGAAAATTACTGCTTA
GTTTCTATCCATTTGCAAAAGTTTATGATTTTTTCAGGCATTCCTCACACCTGTTAGGTT
AAAATCAGTAACACTCTTAAAAAGAAAGCGAGAGACCGGAAATGATATGAGAATAGAATT
GGCCACTCCAGAGACATCTGCAAATGACACTCCATTTTTTCTTCTCGCGCTGCAAAATGT
ACCGGTAAACCGGACTTTCCGGGACTCGCTGGGTGGCCGACATTTTCCCTAGCAGGAATT
TTACGTTTCCAAGATCTCAATGGATGTTAACGGTCGGGCTAAATGCCAGGCAGGTCTTCA
TTGTCGAATTAAACAGCGGTGGGAGCAAGCGGAATAACCGAGTTCCCCTCCCGCACCTGA
GTGCCGGCAGCGAGCCGCGAGCCGGGACCTGTCACCCGCGGGAAGCCCCGGCCGCCCGAC
GAACAGCATCTCCGGTTTCCGCCTCCGGCTCCGGCGCGGCTCCCCCGGCCCGCCTCTGCG
TCAGGGACGCGGAAACCCCGTAGGAGCAGGGCGGGCGGGGAAAGCGAGGTTTAACTAACT
CCGCAGCGATATTCTTCCGCCGCGAGGTAAAGAGTCCAAACCCAACCCCGGGCCCTAGGA
TTTCCAGCGACCTGTAATATCGAGAAATTACCACATTTGGATTTTTCTACCAACTTGCTT
AGGATTTTATCCGAGGTAACGACCCCAGGATCACAATTTTGTAGCTGACCGAAGCACGGC
GAGAAAATTCCTCCGCAAGAAACGGGTTCCGGCCACGAGCCTATAAAAAACGGGTGGCTG
GGCGCTGCTGTCTTTTCAGTCGGGCGCTGAGTGGTTTTTCGGATCATGTCTGGTGGCTCC
GCGGATTATAACAGGTATGCAGTCTGTTGGCGGTCGCGGTCTGTAGTGAAGGTCATAGGG
CGCCAGGGGAGATGATAGTGGATGGCACGGAGGCAAAAACTCTAAATTAATGGACGTTTT
CTTAGGGTACAGCACTCCTGTGCTCTTCCAGAGCTTCCATGATGGGTAGGGCCCGGATTG
TGGGGAGAAAGACGAAGGTGCGAAACAATGGCCAAAAGGCGTTTTTTCTCCCAGAGTTAC
AAAACCTCGGCTGCTCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGGCAGCGGTCTCCAC
TCGGCCACGGCGCGGAGGCGACGGGACAGGACCGGTGCCGGTGAACCGTTGGCATCGCCC
TCGCCAGGCCGCTCCGCCCGCGTCAATCACCCGGCTTGCGCATTGTTGGGGGCGGAGTTC
GGCGCTCCGAGCTCTCGCGAGACGCTCCGCAGTTGAAACGGGATCGCCATGCGCTCGGGC
CCGGGGGGCTGCCTTTCCGGGCATCCGCAGGCCCCAACCTTTAGGGAAGGCGCACAGTGT
GATATTCGCCCTGCGGCTGCTGCTTTAGCTTGTGCAGGGGAGGGTAACGTGCTGAGACGG
GTTGCAAAGGGCTGTCCGCTTAAGGTGCAGTTGAGGTGGCTTGGAAGGGGTGTCTGACTG
CAGTATTCTTGTCAGCAGAGAACATGGCGGCCCAGAGGGAATGGACCCCGATGGTGTCAT
CGAGGTAAGAAACGGTTGTGGATCTTGAAGCTTTGGAAAGGTGAGTGTGTTCATCTCATT
TATGCGTGCATTATTTTTTCTAACTTACAGAGCAACTGGAATGAGATTGTTGATAACTTT
GATGATATGAATTTAAAGGAGTCTCTCCTTCGTGGCATCTATGCTTACGGTTTTGAGAAG
CCTTCCGCTATTCAGCAGAGAGCTATTATTCCCTGTATTAAAGGTAAAAGAAACTGGCAT
TTTTAGGAAATTGTTCTACATAGACATGAACCATAAAAGGGAAAGTAACCTCTGGGGGAC
TAGCACCTGTTTGTATTCCTTAAAGTGAAATGATGGCAATCATCTTTCGGGACTGACCTG
AAATGAAGAGAATACTCATTGCTGATCACTTGATTATTTGGGCATAATTAATGTTCCAAA
TGGAATACATGGTGTGAAGTAGAAGTGACAATTTGATGTGGGATCGGTAAATGTGTATCC
TACTTTTTTTAGGGTATGATGTGATTGCTCAAGCTCAGTCAGGTACTGGCAAGACAGCCA
CATTTGCTATTTCCATCCTGCAACAGTTGGAGATTGAGTTCAAGGAGACCCAAGCACTAG
TATTGGCCCCCACCAGAGAACTGGCTCAACAGGTATTGATAGTGTAGTTCAAAAAAACTG
CTTGCGTGTTGCATAGGTTTCAGGTTTCACAACTGTGAAGAATTTAAAACTTAGTATAAA
TTGGTCCTACCAGATCCCTCCTTTTAATTGTCCATGCATGCAGGGAGTTTTTGTTGAAAG
TTTTAAAAGAACTGGGTATGCAGGTATGGTTTTTAGGGTTGTATACTAATAGATTGAGAA
TCCGAAGCGCTCTCTTGGATGTACTAGATCTGTCCCCATTTTTTAAGTTTGAATGCAGTT
GTGCAACATGAAAACTGCAGTGACATGTTACCATTTGACTGTCTCCGTAGTTTGTGATGC
ATCTGTTGCATGCTATGTTTTCAAAGCTCACTGCTATATTGGCTTTGAAGTAAACCTTCC
TAATAAAGCTGTAGGCTTTATTGAGGTCAGGATTATATAAGGCACAATACCCTCTGGGGG
AAAAAATCATTTGCCCTAGCTGTAATTACAGAACATAAATTTCACTAGGTACTCCCTACC
TACAGTGAAGAATAATGTAGGAAACGTTATTCTTGAATTGTCTAGCTGATGGGTGGAGCA
GCAGCATCCCAAGTTTGACAAGGCATAAGAAAGACATTAAGAGAATTTTACCTTGCAGCA
GTTAGGTCGTCTGCATTTTAAGCTTGGAAGTAGTTTTGTGCTGTGCATGCATAAAAGCTG
TTGGCAGACCAGATTATATTTGTCATTATGCTTTAAAAATTAGTCATTGATCCTGGTGTT
CTGCAGGATAATAATTAAGGCTTGGTTTTTAGATCCAAAAGGTAATTCTGGCACTTGGAG
ACTATATGGGAGCCACTTGTCATGCCTGCATTGGTGGAACAAATGTTCGAAATGAAATGC
AAAAACTGCAGGCTGAAGCACCACATATTGTTGTTGGTACACCCGGGAGAGTGTTTGATA
TGTTAAACAGAAGATACCTTTGTAAGTATTGTCTTTAAGAGAGTATTTTTTTTTTTTTAA
CACTGTTAACATAGTTGAAAAGTCAAATCGTATCACTGAGTAGATCTAGAAATGACAGTA
TGACTTTGTTTCTAACAGCTCCAAAATGGATCAAAATGTTTGTTTTGGATGAAGCAGATG
AAATGTTGAGCCGTGGTTTTAAGGATCAAATCTATGAGATTTTCCAAAAACTAAACACAA
GTATTCAGGTAAGCATTACTTCACCCCCCTCTTAAAGGTAGAGATGGGGTTTATTTAATG
CAGGTACTGTTACAATACAACTGACGTGTTTTATTGTCGTTCCCCCTGCTTAAAGCACTT
GATGCATAACTCTCTCTAACTCCATTCCGTAGTAAGACAGAGACGCTTGGCTTCAAACAT
TTTCCTTTGGGTATTAATGTGTAAGTTGTGCTACAACATAATTTTCTCTTTTTAAGGTTG
TGTTGCTTTCTGCCACAATGCCAACTGATGTGTTGGAAGTGACCAAAAAATTCATGAGAG
ATCCAATTCGAATTCTGGTGAAAAAGGAAGAATTGACCCTTGAAGGAATCAAACAGTTTT
ATATTAATGTTGAGAGAGAGGTAACTGTCTGATTGTTAGACATTATTTTACCTTCTTGTA
TAAGCACTGTGCTAAAATTGCAGACACTAGGACCATGTCTTGGTTTTTGCAATAATGCTA
GCAGAGTACACACAAGAAGAAAAGTAACAGCACTAGATTGTAAAGACTGGGGTGGACCTC
TTTCTTAATGTCCAATGTCCTTTGTCTTAAGATTTGGTGCAATATCTCATTAGACCTAAC
AGAATGAAGTTAATTTTTATAATTTCTACGTTTTGAGACTGGGTTATGAGACTGGCTAAG
ACTGGCCAATTTTGGTATTTTGGGTAGAGACAGTTTCACTTTCTTGAAACCCTGGTCTGG
TTGGAACTCTGGGCTCAAGTGCTGGGATCCCAAAGGGCTGGGATTACAGGCATTAGCACT
GTGGCTGGCCCAGAATGAATTTTTAACTGAAGAGTTGGAAAAACTAAATGACTGTTAACT
TTATCTTCTAAACATTACAGGAATGGAAGTTGGATACACTTTGTGACTTGTACGAGACAC
TGACCATTACACAGGCTGTTATTTTTCTCAATACGAGGCGCAAGGTGGACTGGCTGACTG
AGAAAATGCATGCCAGAGACTTCACAGTTTCTGCTCTGGTAAGAGGTGTTCTAAAATGTC
TGGATTTCCACTAAAGCAGGATTCAGACTACAGTATAGCTGCTAAGTGCTGTGTTGTCGT
TCCCCCTGCTTAAAATAAAGTTGTTTCTTAACTATACCTGTCTGCTATTCTCCTGTAGCA
GCCAGGGACGCTTGGTCTCATACATGTTGATTAAAATTAAATACTGACCTGACTGGTGAT
TCTTGAATTAAGGTTTATTAATTTGCAGCATGGTGACATGGACCAGAAGGAGAGAGATGT
TATCATGAGGGAATTCCGGTCAGGGTCAAGTCGTGTTCTGATCACTACTGACTTGTTGGT
AAGTCTCTTAATGCTTTTTAAAAATCTACCAAAAGTTAGCTTTTTGGGGGGCAGGTTTTT
AAGTAACCTTTGCCAACTTGGGCTATTTGGAAGAGTAAAAGACCACACTCCACAGTGGGC
TATACCACTTAGTATAGTTCGCTACTATTTTGTGGCCTACATGACAGGTGTCAAGTTTTT
TTGAATCAGAATTTTTAAAACATGCCATTGTGTTTCAGGCTCGCGGGATTGATGTGCAAC
AAGTGTCTTTGGTTATAAATTATGATCTACCTACCAATCGTGAAAACTATATTCACAGGT
GAGAAGCCAGCATCTTGGCTGTATTGAAAAAAATTCATACATTTTTCTACTGTGATGTGT
ATGAAAGGTAACATCAAATCAAGGAATAGATTCAGTAAAGTCAGTAGTGTTCAGTAAGAT
GATGTAATTAAATTTGTACTAGGGAAGGTTGATGAGAACAAAGTGGGAAAACTTGTAAAC
ATTGCCCAGATTGTGGACATAGGTTTTTTTTCCACAATTGTTGGTCTTACCTTATGCTTG
AGCTTTTAGTGATGTTCTTGTGTCCATGTGTTTTTCTTCGTGATTTTTTCTATAGTTGGG
ATTTTCTTGGTGTCGCCTGGTAGCAATTTGAGTGAACCCTGGTTTAGTTATAGTGGCTTT
ATCCCTAAATAAATTGAATTGTACTTTGTTATATGATGTAAAAAAAGACTTTTTAAAAAA
TACAGGAGTCGATAGCAGCAGTTGATGACGAGATGGCACTCAGAAACGGCGTTGACGTAA
TTTAGGACGTGGAATCATAAGCGAAACAGCACACTGTTTGAATAAAGAGCGAGTCGGTAT
TTATATTTGTTTTTCTTTTGTCATGATTATTTGATTATTTTTAAGTTGCTCCAGCTAAGG
CATTTTTTTGTATTAGTATTTCTATCAGGGAACCTTTCTTATTAGGTGGTTTGTATTGTC
TGGTTTCTAACATGCAGGTAGCTGTTTGGCAGTTAAACACGTTTAGAGTAATTTGAGTTA
CAACGTGTGAAACTGAGCAAAAAAGCAGTGATAAGTTTGGGTTACCATACCAAATATTTG
TTTTCCCACTGGAAAAAAGTAAGTTTTAGCAAATAGTTAACCTTTGCAGCATTTGTTTAC
AGTTTACAGTTCCAGAAGTGCGTCGAAATGGATTACATAACTGCTCTTTTATTCCTGGTG
TTCACATCTGTCCCAGGCTGACACCTGCTCTTGGCTGGCCCACTTTGGTATGGGCTTTAA
TTTCACTACCCCAAACACGATACTGTCATCTGCTTTATAATAATGCTCAAGATGCCTGAT
AAAAATCTCATTTTGCAGCCAGACAAGCCTTGAATCCTTTTGGCACTAACTGCAAAGGAA
GATTTTTTTCTCTAGATATGCATTAGCAGCTAGTGCTCCAGTTAGAAGCACGAACTATAA
CCTTGATAAGTAAACAGCAGCTGGTGGTTAACAAGTGGATCGTCATGTTCAGTAGTTTAT
ACATTATGTGAGAAGTAACATTCTGATTGTTTCTTTTTCTTACACAGAATTGGCAGAGGG
GGTCGATTTGGGAGGAAAGGTGTGGCTATAAACTTTGTTACTGAAGAAGACAAGAGGATT
CTTCGTGACATTGAGACTTTCTACAATACTACAGTGGAGGAGATGCCCATGAATGTGGCT
GACCTTATTTAATTCCTGGGATGAGAGTTTTGGATGCAGTGCTCGCTGTTGCTGAATAGG
CGATCACAACGTGCATTGTGCTTCTTTCTTTGGGAATATTTGAATCTTGTCTCAATGCTC
ATAACGGATCAGAAATACAGATTTTGATAGCAAAGCGACGTTAGTCGTGAGCTCTTGTGA
GGAAAGTCATTGGCTTTATCCTCTTTAGAGTTAGACTGTTGGGGTGGGTATAAAAGATGG
GGTCTGTAAAATCTTTCTTTCTTAGAAATTTATTTCCTAGTTCTGTAGAAATGGTTGTAT
TAGATGTTCTCTATCATTTAATAATATACTTGTGGACTAAAAGATATAAGTGCTGTATAA
AATCAGCCAATTATGTTAAACTAGCATATCTGCCTTTATTGTGTTTGTCATTAGCCTGAG
TAGAAAGGCCTTTAAAATTTTTTTAGAAAGCATTTGAATGCATTTTGTTTGGTATTGTAT
TTATTCAATAAAGTATTTAATTAGTGCTAAGTGTGAACTGGACCCTGTTGCTAAGCCCCA
GCAAGCAATCATCCTAGGTAGGGTTTAATCCCCAGTAAAATTGCCATATTGCACATGTCT
TAATGAAATTTGAATGTTAAATAAATTGTATATTCACTTTAAAGGTGCTTTTGGTCATTT
TATTTTTATTACAACTCCATTATTTACAAAACTCCCCATCCAGATAGATTCACGTTAACA
ATTCTGAGATAACTGTTGCATCACAGTTGCACAAAGGCTGATGAGTTGCAAATGTTCATC
AGCACCATCTGCTAGGCATTTGTCAACTTCCTACGAGAAAAATTTAAGAAATTAGCATCC
TTCAGGTAGTTAAATGTCCCATTGACATGTGCAAAGTACCTACTTACGGCAAGTTTTTCT
GTGATAATAGACTTCTGTTTATCAGATAAGTTATTTTCTACAACCACATCATGGACTTGA
TTGACGAGCTGAGTTGCTGCATGACCCTCATCTATTAAATCCTATAATAAAAAAAACTTT
TGGTATGATGACTTAATATTCCTTTCCCCAAAGTTAGTAAGCTGACTTTACCTTGACCAC
AGCTTCTAGTTTGTCAAAAGAGCCACTCTGACAGGCAGCAAATACTCCATCAATTTTCTC
AGCTGGTATTACCTAGGTAATTGAATGTTCGGTATTAAAGATGTTTCTAGGTGAGACTAG
ATGTACACTCTGCCAACTGGCCCCCGTGCCCCCAGTCCTTTCTGTTCCACACCTAAGTTC
CATACTTTTCTGGGAAGGCTTTGGGAGAACACAAAGGGCCAGAGTAACTCCAGTCACCAC
TAAGCAACCAAGGTGCTAACAACTGTGCTTTTAAAGCCCTTTAATGGCTTCTTTGTGAAC
TTCCAAGTTTGGGCACACATGGATTATAGCTTGTTCTGGTCAGTGGATGAAGATTAAGTT
TTCCCTTAGTGGCTATAACGATTCCTCAGAACAGTGGCCAAGATCAACCAAAAAGACTGA
TTTCTTTAAAGGGGAAGTGCCCTTTCTCTCAATCTCTCCATGTAAAGATGCCACTTAATG
AGATTGGTTTAAAAAGTCCACAATATCCAGAAAATTAAAGAGGATT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1093, 1998..2043, 2130..2262, 2532..2671, 3452..3620, 3738..3847, 4076..4219, 4700..4837, 5068..5157, 5378..5457, 6707..7445
1065..1093, 1998..2043, 2130..2262, 2532..2671, 3452..3620, 3738..3847, 4076..4219, 4700..4837, 5068..5157, 5378..5457, 6707..6848
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved