Pan_troglodytes Locus XR_020516.1
snOPY snoRNA Orthological Gene Database
Pan_troglodytes XR_020516.1
Pan_troglodytes
XR_020516.1
3
SNORA62, SNORA62
5559..5709, 8412..8565
10899
GGAGTGCAGCGGTGCAATCACATTCACTGCAGCCTTGACCTCTAGGCTCAAGCTATCCT
CCCGCCTCAGCCTCCTGAGTAGCTGAGACTACAGGCACGCACCATCATGATTGGTTAATT
TTTGTATTTTTTGTGGAGATGGGGGTCTCCCCATGTTTCCCAGGCTAGTCTTGAACTTCT
GAGCTCAGGCAATCCACCCACCTCGGCCTCCCAAAGTGCTGGGATTACAGGCACAAGCCA
CCGCGCCCGGCAAACTTATCTCCTACTGATGGATATTGCAAAATTTTTCTTCTACCAAAA
AAAAAAAAAAAAAGATAGATAGATATAATCCATACCATCTGTTCAATCTTGTCCTTTTTA
ACTTTTTCAGGGAAACTTCCCCCAGGTGATAGATGGATAGATACATGAGATAGATATAAC
GCATGAGATAGATATAACGCATACCAAAAAAAAAAAAAAAAAAAAGATAGATATAATCCA
TACCATCTGTTCAATCTTGTCCTTTTTAACTTTTTCAGAGAAAACTTCCCCTAAGTGAAC
ATTTAAATCTGAATTACGTCCTGTTAAACTGTTCTCCAGGAAAATAAAATAAAATAAATC
TTCAAGTTTTTGTTTACCTAACAATTTGTCGTGTCGAACAAACCTTCCTACTTTTCAGGT
AACAAAATGGCAGCTTAGGCTAGAAAGCCGCTCATATTCGCAGGTACAAGGGCTGGGTAA
GAACGCCCCGCCTGGCTGACTAACTTGAGTTCCGCGCTCTGGACAGGAATTATGCACAGG
GCGTCGCTGTGGCACTAGAAACCCCAAAGTCACAAGCGCCCCAGATCCGACCAGGATGCC
GCTACCGGATACAGCCCAGTGGCCCGCTCCTGCGGCGCAAGCCCGCCTTCCTGAAGAAAA
AGCCCAGTCCCGGCAGCGTTCTTCTCCGGCTCCGCCCTTCTTCCGCTCGACTTTCTTTGC
CATTGGCTGACAACGGAGTACATAAGGACGTCATTTCCTGCCGCCTGTCTTTTCCGCGCT
ACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGGTGAGTTCCGTGTAGCGTCCCTGGCGC
CTTCCAGGGCTAGAAAAATGAGCTTTTCCTGCTCAAATGAAGGGTGAGAAGACTAGTGAT
GAAAGCCGGTCAGACTGGATCTGTCTCCCGCCCGGCGCGCCCCACCTTAGGCCTGCGGCC
CGCACGTGGCCAGGCTCGGGCCGGCGGGTTCCCAGAGTGCCCCGGGAGCGGGTGGAGGCC
GCCCTCCAGCGGAGGCTCCGAGCTGGGGTTCGGACCAGGCCGCGGGTGGGCGGGAGTGCA
GAAAGCGGGCTAACATCCTGTGTTGCTATCCCTTCGGAGCCCCACACGGCGGTGAGTCGA
GGCCCAGGCGCTGATTTACACCAGCTACTTGGGCTGGTCGGGTTTTCCCGTTCGGGCTGG
TCGGGTTTTCCCGTTCGCGCCGTGCGGGTCAGGAGTTAAGGTTCTCGGGTTTTTAGACAG
ACAAGTGGTGACAGCACAGCGAAGTAATTCCAAAGCATCCGCCTACAATCTGCTTGAAAA
TGTCTGAAAACAATTCATGCCTTTTTTGCCTTTAGTTTGCATATTCCAAACATGGCTGCT
CTTTTATATCTAGTTGTTAACTTGGCGCATCCACAACTTTTCCTTAATTCCTATCTTGAG
AAGTGTTGAATTTCCATTCGCTAATTTCGTGTAGTTTTATTACTCGGTTACTCTGCCGTC
CACACTATTTCCTCAGTAAGATGTGCGCTGTTCCGTAATACACGACATGTATGGGTTAAC
TTTCTGTTTACCCTTCACTACACTGTAAGCTCAATGCCTGACACTATAGCAGATGGAGTT
TTTAATGGTTTTAAGGGTGTGCCCTACTTAACTCAATGGAATGAAAAGAAANNNNNNNNN
NAAAGTGTATGTTTCTTCTCCTGTTAATTTGTCTATTGTCAGTTCATTTAGCAGTGAACA
CTCAGAGGGTGGAGGGGAAGCCCCTACAAGAGCTTTAAAAGCTACTGATGCTTGGGTCTC
ACTCAGAGATTCTGATATATTCAGCCCAGGTGTAAGATTTTAAAAGCTGCCCAGGTGATC
CTAATGCCAAGGCTGAGACCCCTGGAGGAACCCTGCAGAGCTGCACTCACTACTCAGCAA
TCCCAATCAACACGTGAAGGGTTAAGCAGGAGTACATTTGGGTGCAGGGGGCAGGGCATT
GTTTTGGGACTCAGGGGCCTCTGAGGAGGCTTGTGGCCTGAGTTTCTGCCAACAAACTGA
ATGCCTCCTCTTCCCATAACAAAGCATAGAAGCGGGAGGCATTTGCCGCAAGGGGCTGTG
ACTTCTCTGAATTTGTCCTTCAAGCCCCAGGTGCTTCAGCCTTGGTGGGTGATGAAGCAG
AGCAGCCTGGGGGTGACCTGTGCTAGGGTCCAAGGGTTTCCAAGCTCCTCAGAAAATCAT
ACTGGCTTCAGTGGAGCTGCAGAGCCACTTGCAGGAGAACCTGGATGTGCTGTCCTTTGG
ATGAGTGGCCATAAGGGTCTACGAGTTCATTTTAGGGTGGGCTCAGAAATCAGATTGACT
CAGCAGGCCCCAGAGAGGAACCTGCACTTTTTTTTTTTTTTTGACGGAGTCTTACTCTGT
CGCCCAGGCTGGAGTGCAAGCGGCGCAATCTCCACTCACCACAACCTCTGCCTCCTGGGT
TCAAGCAATTCTCCTGCCTCAGCCTCCCCAGTAGCTGGGATTACAGGCATGCCCGGCTAA
TTTTTGAATTTTTAGTAGATACCGGGTTTCGCCATGTTGGCCAGGCTGGTCTCTTGAACT
CCTGGCCTCAAGGGATCCGCCCGTGTCAGCCTCCGAAAGTGCTGGGATTACAGCCACCGC
GCCCCTTCAATTAACTCCTATTTTTTTGTTTGTTTTTTGGGGACAGAATTTCGCTCTATT
GCCCAGGCTGGAGTGCAGCTCACATTCACTGCAGCCTTGACCTCTAGGCTCAAGCTATCC
TCCCGCCTCAGCCTCCTGAGTAGCTGAGACTACAGGCACGCACCATCATGATTGGTTAAT
TTTTGTATTTTTTGTGGAGATGGGGGTCTCCCCATGTTTCCCAGGCTAGTCTTGAACTTC
TGAGCTCAGGCAATCCACCCACCTCGGCCTCCCAAAGTGCTGGGATTACAGGCACAAGCC
ACCGCGCCCGGCAAACTTATCTCCTACTGATGGATATTGCAAAATTTTTCTTCTGCCAAA
AAAAAAAAAAAAAAAAGATAGATAGATATAATCCATACCATCTGTTCAATCTTGTCCTTT
TTAACTTTTTCAGGGAAACTTCCCCCAGGTGATAGATGGATAGATACATGAGATAGATAT
AACGCATACGATCAGTTCAATCTTGTCCTTTTTAACTTTTTCAGAGAAAACTTCCCCTAA
GTAAACATTTAAATCTGAATTACGTCCTGTTAAACTGTTCTCCAGGAAAATAAAATAAAT
CTTCAAGTTTTTGTTTACCTAACAATTTGTTGTGTCGAACAAACCTTCCTACTTTTCAGG
TAACAAAATGGCAGCTTAGGCTAGAAAGCCGCTCATATTCGCAGGTACAAGGGCTGGGTA
AGAACACCCCGCCTGGCTGACTAACTTGAGTTCCGCGCTCTGGACAGGAATTATGCACAG
GGCGTCGCTGTGGCACTAGAAACCCCAAAGTCACAAGCGCCCCAGATCCCACCAGGATGC
CGCTACCGGCTACAGCCCAGAGGCCCGCTCCTGCGGCGCAAGCCCGCCTTCCTGAAGAAA
ATGCCCAGTCCCGGCAGCGTTCTTCTCCGGCTCCGCCCTTCTTCCGCTCCACTTTCTTTG
CCATTGGCTGACAACGGAGTACATAAGGACGTCATTTCCTACCGCCTGTCTTTTCCGCGC
TACCTGCAGAGGGGTCCATACGGCGTTGTTCTGGGTGAGTTCCGTGTAGCGTCCCTGGCG
CCTTCCAGGGCTAGAAAAATGAGCTTTTCCTGCTCAAATGAAGGGTGAGAAGACTGGTGA
TGAAAGCCGGTCAGACTGGATCTGTCTCCCGCCCGGCGCGCCCCACCTTAGGCCTGCGGC
CCGCACGTGGCCAGGCTCGGGCCGGCGGGTTCCCAGAGTGCCCCGGGAGCGGGTGGAGGC
CGCCCTCCAGCGGAGGCTCCGAGCTGGGGTTCGGACCAGGCCGCGGGTGGGCGGGAGTGC
AGAAAGCGGGCTAACATCCTGTGTTGCTATCCCTTCGGAGCCCCACACGGCGGTGAGTCG
AGGCCCAGGCGCTGATTTACACCAGCTACTTGGGCTGGTCGGGTTTTCCCGTTCGCGCCG
TGCGGGTCAGGAGTTAAGGTTCTCGGGTTTTTAGACAAACAAGTGGTGACAGCACAGCGA
AGTAATTCCAAAGCATCCGCCTACAATCTGCTTGAAAATGTCTGAAAACAATTCATGCCT
TTTTTGCCTTTAGTTTGCATATTCCAAACATGGCTGCTCTTTTATATCTAGTTGTTAACT
TGGCGCATCCACAACTTTTCCTTAATTCCTATCTTGAGAAGTGTTGAATTTCCATTCGCT
AATTTCGTGTAGTTTTATTACTCGGTTACTCTGCCGTCCACACTATTTCCTCAGTAAGAT
GTGCGCTGTTCCGTAATACACGACATGTATGGGTTAACTTTCTGTTTACCCTTCACTACA
CTGTAAGCTCAATGCCTGACACTATAGCAGATGGAGTTTTTGGTTGCTTTTAAGGGTGTG
CCCTACTTAACTCAATGGAATGAAAAGAAATAGATTGCTCTCTTATTTCAGATTCCCGTC
GTAACTTAAAGGGAAACTTTCACAATGTCCGGAGCCCTTGATGTCCTGCAAATGAAGGAG
GAGGATGTCCTTAAGTTCCTTGCAGCAGGAACCCACTTAGGTGGCACCAATCTTGACTTC
CAGATGGAACAGTACATCTATAAAAGGAAAAGTGATGGTTAGTCATTGCTTTAATTTTTT
GTTACTCCAGCTGTAAGTACAAATTTTGAGCTTGCTATTCTCGTGGTTAGTTCTGGGTAA
TTTCTTTCTGTCTTCCTTAAATGAAGCCAGACCCCTACGTTGAAAACATACTTTAAATAA
ATGTTCTTGTTATTAGGAGAAAAGATTTCTGCTCCAGGGGAGGAATATGTCAGTTGTCTG
AGTTACGGGACTTGGGTTGGGTCATGAACATGAGAAAGTTCATTGGCTGAGTTTCTGATA
GCTCGCATAGTGCCTTCAACTTCATAGGTACTTACACAGGCTATTGAACTGAATTTTGAG
TGGAAAGTGGGGTAAGAGGTGGGAATGAACAATATGGTTTGGAAGAACCAGAGGATGGAA
GGCATTAAGTTGGCTAAGGCGCTTACTTATTTTAGAGATAAAGCTACCAAGGACTTGGGA
GTGACATGCTGTAAAGGAGTTTTAGGATGAATCTTGCATCAGTGCAGATGATAAAAGGGA
AAGAGTGGCAGAAAGCCAGGAAGTGGATTCTTAAGAACCAATGATGGAATAAGTACAGGG
AAAGAGAAAGGAAAGATGGATTTAGCCAACTGAATCTAGGCTGCACACTATTAAAGCTCA
GGGTGGAGGCCAGTCTTGGCTTATGAACTTCTGAGTGTCGGAAGTGTGCTATATCAATGG
CAGGATTTTCGCTAACACCAGTAGAGCTTGCCTCTATGACTGGAGTTTGGTAGTACTCGC
TGCCACATAGAGTAAACTTGAGAAGAATGTTTGCACAGCCAGGTCAAGTGTTACAAATCC
TTCTGCCCTCACTTAGGCATCTATATCATAAATCTGAAGAGGACCTGGGAAAAGCTTCTG
CTGGCAGCTCGTGCTATTGTTGCCATTGAAAACCCTGCTGATGTCAGTGTTATATCCTCC
AGGAATACTGGCCAGGTTTGTGGAACAGTGGTTATTTTTTATATTATAAAAATAAAGCTT
ACAGACATTGTGAGACATCTAGAAAGACATAAGAAAACAGAAATAACTCAGGCCGGGCGC
AGTGGCTACGCCTGTAATCCCAGCACTTTGGGAGGTGGAGTCCGGCATATTACGAGGTCA
GGAGATCCACACCACGGCGAAGCCCCGTCTCTACTAAAAATACAAAAAATCAGTTGGGCG
TGGGGGCGGGTGCCTGTAGTCCCAGCTACTCGGGAGGCCAAGGTGGAGAATGGCGTGAAC
CCGGTGGGCGGAGCTTGCAGTGAGCTGAGATGCGCCACTGTACTCCAGCCTGGGTGACAG
AGCCAAGACTCCGTCTCAAAAAAAAAAAAAAAAAAAAGAAAATAGAAAACTCAAACTCCA
CTGTTAGAGATCTTAAGTTGGACTGAGCCATAGAAGTCGCCCTTATGACCTTCCTTTTTT
TTTTTTTTTCCTTCAAGACAATCTCTCGGTCTGTTGCCTGNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGATCTCACTCTGTGCCTCAAGCAATGAGTCGAGTGGCATAATTATAACTTA
CTGCAGCCCCCAGCTCCTGACCTTGAGGGATCTCCTGCCTTAGACTCCCAATTAACGGGA
AGTATGGGTGCATGCCATCATGACTGGCTAAGAGTCTTAAAAAATTTCTGTCCCAGTATT
TCATTGTTTTAAGGTAAAAACTTTGACTATGGGAAAATGTGATAAGCCACTTTAATAGAA
TTTCTAGATATTTAGTGGCACAAGTCTACACAAAATGAAATTATAAAGTTCAACATACTG
CCAGATGCCCAGCCTGTAAGACCTTTTCAACATACATGCTGGGCATCTGGCAGTATGTTG
AACTTTATAATTTCATTTTGTGTAGACTTGTGCCACTAAATATCTAGAAATTCTATTAAA
GTGGCTTATCACATTTTCCCATAGTCAAAGTTTTTACCTTAAAACAATGAAATACTGGGA
CAGAAATTTTTTAAGACTCTTAGCCAGTCATGATGGCATGCACCCATACTTCCCGTTAAT
TGGGAGTCTAAGGCAGGAGATCCCTCAAGTCCAGGAGCTGGGGGCTGCAGTAAGTTATGA
TTTTGCCACTGCACTCCAAGCCTGGGGCACAGAGTGAGATCCTGTTTCTTAAAAAAAAAA
AAGCCAGTCATGGGTGGCTCATGCTTTTGTAATATGGGGTACTTTGTGAGGCTGAGGCTG
GTGGCTTGCTTGAGCCCAGAAGTTCGAGACCAGGGTGGGCAACGTGGCAAAACTCCGTCT
CTACCAAAATTAACAAAAACGAGCTGGGTGTGGTGTTGCGTGCCTGTAGTCTCAGCTGAG
GCTGAGGTGGGAAGATTGCTAGAACACAGGAGGTTGAGGCAGCAGGGAGCCAAGACTGTC
CACTGCATCCCAGCCTGAGTGACAGAGTGAGGCCTTGTCTCAAAGAGAACCTCTGCCAAC
TTGAATGAAAAATACCTTAATTTGTATTTTTAAGAAATGACTAGTTAGTAAAACTTGAAT
CTTTTTTGCCACAGCTCTATTTTAATAATTTTTCTGTTGAGAAAACTAGTAGATTTCTTG
AATTCTAAGAGTTCTAACAGGGATTTTATTCATCTTAACTATTTTGACAGATTTTAAAAT
TATGTAGTAAGACTTTATTTCAATGTTGACAGGACGGGTTCCCATGTGTGTTTTTGCAGA
GGGTTTTTCCAGAAACTGACTTGTTACTAGGACCACATAGTTTGGTACACAGTAGAAAAA
AGGCAGTTAGTTATTGCTGTAGAGTGAACTGAGTGACAGTTCTTGCTTGCTTGAGAAAAA
TATACTGAGCATCTAGATTGGGCCAGGTAGTGTTGCTAGGTGCTCCGGATATATAGTAGA
AAAACAAGCCTGTCTTTTTTAATGTATGCAGGAAATCTCTGGAGAAGTAAGAGAGGTTAA
GGAAAGCTGAGTATGTGCCTGCTTTACATGAAGTAGTAGTGATTAAGTTGGCCAGTGCCC
AGAAGTGCTTACTGGGTGCCAGGATTGTTGCTATGGAATATCGAGTACCACTAACTTTTA
AATTCTTCAAAGAGGGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTCCAATTGCT
GGCCGCTTCACTCCTGGAACCTTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCACGG
CTTCTTGTGGTTACCGACCCCAGGGCTGACCACCAGCCTCTCACGGAGGCATCTTATGTT
AACCTACCTACCATTGCGCTGTGTAACACAGATTCTCCTCTGCGCTATGTGGACATTGCC
ATCCCATGCAACAACAAGGTAATGATTTTAGGATCTAGAGTTTGTGAATGCGTGCTCTAG
AAAAAACATTCCTGTGCACATTGTTAGAGCTTGGAGTTGAGGCTACTGACTGGCCGATGA
ACTCGCAAGTGTAGGTAGTGTGCTACATGAGGGGCAAGTTTTTCGCTAACACCACAAGGG
TCTCTGGCCCAATGAGTGGAGTTTGATAGTAATACTTGCTACAAGTATAACATTACTGTA
TGACAGCTTTGTGGAGAACTGAAAACATTTGGAAAATAGTGTGTTTTCTTCTGCCTTTGT
CCATGTTTCTTGCTCAGGCCTCAGGCACTTGGCCTTTGTTTTCACACCAACTTGATGGGT
TCTACTATAAGATGCTAAAAAGGTGGGTTGTGTGTGGTTCAGATTGGTTGATTTGTAACC
CTAGTTGTGCATAAGAATTGCCCAGATATTTTTTTTAAATGCTAGTGTCCAGGCATTTTT
TTTTCAATCCCTATCATTCCAATGTGCAGACAAGGTTGAAAATCCCTATTTATAATGCTC
CCTGTTACAATTGCTTTTCAACTAAGAGATGTCTGTACTTTTGGTACCTAGATGATGTAA
GAGCCAGGAAGGTGCTTGCTGTTTGGGTTTGACCAAGTGTCACTTTTTAATAATCTGCCA
CTCTTGGCAGGGAGCTCACTCAGTGGGTTTGATGTGGTGGATGCTGGCTCGGGAAGTTCT
GCGCATGCGTGGCACCATTTCCCGTGAACACCCATGGGAGGTCATGCCTGATCTGTACTT
CTACAGAGATCCTGAAGAGGTAAGCTTCTCCAAAGGCTTGTGGTTACATAAGCAAATTGG
ACAACTTGGACTGTGCTTCTAGGAATCAAAATTTGTCAGTCCCTGTAAATCTTTCCTCTT
TTTTTTTGTAACCCAGATTGAGAAAGAAGAGCAGGCTGCTGCTGAGAAGGCAGTGACCAA
GGAGGAATTTCAGGGTGAATGGACTGCTCCAGCTCCTGAGTTCACTGCTACTCAGCCTGA
GGTTGCAGACTGGTCTGAAGGTGTACAGGTGCCCTCTGTGCCTATTCAGCAATTCCCTAC
TGGTATGTATCAGGATAGAGGTGCATCAAGCTGATATTTTGCAACTTCTCAGTTTTATTC
TAACTTTAATGATCTCTGTGACTTTTATACTAGCTTTAAGAGGTTTTCATCCCAGTGTGC
TACAGCATCTGATAGACTGCTGTTGGGAGTAGGGTAAGGAAAAATACTACATTGAGGACA
GAGCTGATGGCTCTTTTTGGTATTCTCTTAACAGAAGACTGGAGCGCTCAGCCTGCCACG
GAAGACTGGTCTGCAGCTCCCACTGCTCAGGCCACTGAATGGGTAGGAGCAACCACTGAC
TGGTCTTAAGCTGTTCTTGCATAGGCTCTTAAGCAGCATGGAAAAATGGTTGATGGAAAA
TAAACATCAGTTTCTAAAAGTTGTCTTCATTTAGTTTGCTTTTTACTCCAGATCAGAATA
CCTGGGATTGCATACCAAAGCATAATAAAAAATACATGTCTCAACATGAGTTGTACTTCT
AAAGCCCACTGTAGATAGTGTATATTGCTTTTCACTTGAGAATTTCCCTGAGCTTCCTTC
CTGTGTGGAGAACATGTGTGCCCTGAAAATAGATATAAGTGGTTACACATACTTAGTCGG
TAACCTCAGGAATACTTTTCCGAGGCCCTGATGATCTTGCTTTTATTACCATTTGCGTAG
GTAAGTTCTATAGAGCTTAGGTTTTTATTTTTGAGAGTCTTCCTGTCACTTAGGTTAACT
ATTTCTGGAAGCCCTGGAGAGGCGATGGCCCTTCCCCACATTGAGAGACATTAATCGCCT
CTCTTGTCAGCTTGCCTACAGGTTCTGGGAGAGGAGAGGTATGTATGTATTAAAAAATGT
GATGTTCTCCATATTTGTCTTTGCCGGGGAGGGGGTTGGGGAGACAGTCTTTCCCTGTTG
CCCGGGCTGGAGTACAGTGGCGTGACCTCAGTTCACTGCAACCTCTGCCTCCTGGGTTCA
AGTGATTTTGTGCCTCAGGCTCCTGCGTAGCTGGGATTTCAGGTGTGCACTGCCACACCT
AGCTAATTTTTGTATTTGTAGTAGAGATGGTTCTGCCAGGCTGGTCTCCAACTCCTGGCC
TCATGTGACCCGCCCCAAAATGCTGGGATTACAGGCCTGAGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1052, 4791..4956, 5776..5894, 8112..8357, 9010..9138, 9256..9421, 9634..9899
4824..4956, 5776..5894, 8112..8357, 9010..9138, 9256..9421, 9634..9725
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved