Pan_troglodytes Locus XR_022611.1
snOPY snoRNA Orthological Gene Database
Pan_troglodytes XR_022611.1
Pan_troglodytes
XR_022611.1
3
SNORA7
2133..2271
8640
CGCGCCACCAGCCCCAGCTAATTATTTTATTTTTTGTAGAGACAGGGTCTTACTATGTT
GCCTAGGCCGGTCTTGAACTCCTGGGCTCAAGCAAATCTCCCACCTCAGACTCCCAAAGT
ATTGGAATTATAGGTGTGAACCATAGTGCTCAGCCAATTTTCACAATAATCTTAAATACA
AAAGCTAAGCAAAACAAATCAAGAGCATCTTTAAAAACTAGGCAGTCTGGGAGGCAGGGG
CTGCCGTGAGCCGTGAGATGGCACCTTTGCATTCCAGCCTAGGTGACAGAGGGAGACCCT
GTCTAAAAAAAACCAAAAACCAAAAAACAAAACAAAACAAAAAACGTCTAGGCAGTAGCT
CGTGCCTGTAATCCCAGCTACTCAGGAGGCTGAGGCGAGAGAATCGTTTGAGCCCAGGAG
TTCAAGACCAGCCTGGGCAACAGAGTGAGACCCCATTTCTAAAAAATGAACAAACAAAAA
CTAGGCAGTTTCGCCCAGTGGTTAGAAGCGTGGAGTTTGGAGTCAAGTCTCCAAATTTCA
TCTTCCACATATGCAAAATGGAGACAATAATAGGGGTACGTTATAGAATTGTGGTAGGCA
CAGTGAACTCCATCGCATGTTAGCTGTTTTCGTTACTATTTACTGTCTAAATTCGGTGAT
GAAATTATTAGGAAGTCTCTGTCTTGTTCTCTTCTGACCACTAAGAGGCGCACTTCGGAG
TAGAAGAAACGCGGGCGGAAATAGCCCAAAAGCGGATTGGCTTCAACTTCTGGCGGAAGT
AAATTCCTCCCTCCACCAGGTCTTATTAGCTCAGAAAGAATTCCAAATTTCTACCTAGTC
CCAAGGATAGGTAGAATACATTTCTCAGTCCTATTCCTAGTTATTATGGTCTATCAAAAC
ATGTATACTCAGAATTTTTGCGGCATTATTTTTTGACGTGTCTTTATTTTATTTAAAAGA
GCCGGAGCCGGAAGTGCTTGCCTTTTTCCCTGCCAGGACCCAGGGGTTACGTCCCATCAG
CCCTTGCGCGCCACCGTCCCTTCTCTCTTCCTCGGCGCTGCCTACGGAGGTGGCAGCCAT
CTCCTTCTCGGTAAGTGTTAATCCGTGGCAATCCGCATTCCTGCGGGGTTCATCTGGCCC
CGTTGCCCAGTGGTGCGGAGGCCTCCCCTTCAGCGCGGTAGTGTCTGTGGGTATTGTTAT
TGTCAGCTTACCGGAGCGTGTACAGGGACAGAACGAAGCCGCCGAGTTGATAGGGCTTTG
CGTCCCAGAGCCTCCTGCCCTCCGCCTGTAGTCAGAGCTGCGGGCTGCTTGTTTGTTCCT
TGGCGGTGGAGGGTGCTAGTTGAGGCCAGACTTCGGGGTCTCATGGGGGCCGTGGGACGA
CCAGGGGTGGCCCAGCTTGACAGCTTTCAGCTGGGATCTGTGGATCCCAGCGCTCACCAA
TGTCGGCCCACGTGTATTCGTTCATGCCATGGCCGGCTTCTTCCGCTGCAGTCTCTGGCC
CGAGGGCTGCTGCTGCGGGACCGCCAAGGAAAGACGAGCTGTAGGTCGGCTGGTTCAGCT
GCAGGCAGAAATTCTGGTAGTATCTCTGGGAATATGAAGATGCAACTGCCCCCACCTTGC
CTTCGAGGATATCATGGGTCAGAAGGCAGAGTCGTTTTGAATACGTGGTTCATTGAGTAC
CCACTCTGTGCCAGTTGGTGGCTGCGAATAGAGCAGAAGGGGTGCTGCTGTAGGAAATCA
ATGGCTCGGAAGACCACACTGAGGAAGGTGTGAGTTGATACTGGAAGATCTCCAGGTTTG
AGGCATCTTCAGAGGTATATGGTGGTTTTGTGTGTGTTGAGGGTGTGGTAGCGCAGCAGC
TCCCTAGGGAATGAGAAGATTTTATTGAACATTTACCCTGTGACAGGCACTGCAGGCATT
CAGCGCGCAGTGTCATCTTCATTTTACAGGTGAGGAAAAGACTCAGGTTCAAGTAGATGG
TCAAGGCCAGTACTACTGGAAGGACCATCTGGGGGTTCGGACACTGGTGGGGTGGGATTT
GCTGCCCCTTGCAAATTGAGAGTGTCTTGGGGTCAGTTTTGATTTGCTCAGCTGTTGGCA
TTCTTTGGGCTCTGAGTGGGTGAGGTGACCCTTGACCTCCTGGGATCGCATCTGGAGAGT
GCCTAGTATTCTGCCAGCTTCGGAAAGGGAGGGAAAGCAAGCCTGGCAGAGGCACCCATT
CCATTCCCAGCTTGCTCCGTAGCTGGCGATTGGAAGACACTCTGCGACAGTGTTCAGTCC
CTGGGCAGGAAAGCCTCCTTCCAGGATTCTTCCTCACCTGGGGCTGCTTCTTCCCCAAAA
GGCATCATGGCCGCCCTCAGACCCCTTGTGAAGCCCAAGATCGTCAAAAAGAGAACCAAG
AAGTTCATCCGGCACCAGTCAGACCGATATGTCAAAATTAAGGTATGTGGTCCTGGGATG
GAAATGGGTGTGGGGTGAAGAAGAGAGTTTCCAACAGGCCGCCAGTTTCTGACATCACCT
AGTCAGGATTATCTTTGACCGATGAACCGGCTTGTGGAAGAGCTTTCTGTAGAAATACAG
GTCTCCCCCAGTGTGCCCTAGTGCTGGTACTTACGTCTCTTGATGTGTGAAGTGAAACTT
TAATGAAAAGGGACATTTGGCCGTTTTGATGTGTTCAGAGGGCTTTGCATTTGTGTCATG
TATTTTGGGTTGCCTTGTGACAGCAGGATCCCTATTTTATAGACAAGAAAACTCAGGTGC
TGAGAGCAGTGTCTGCAGCTGTGCTTGCCATCGCTATCTACACAGTCCCCTCGCATCCCA
TTGGTGCCTCCTCCATTGCTTGGGAGTGGCAATGGCGGGGGTGCCTTCATACCTAGTGGC
TAAAGCCACGAGCTCCTGGTTTTTCCCACCAAAAAAGTAAGGAAATAGTGAAGTCCTGTT
ACCAAAGGCAACTACTGTGTGGCATACTTCCTTTTCATTTGGTCCTTTTTTCCCTCCCCA
AAAGGAAGAGTTCGCACTCTGCACAGACGCTAACCCACTTGTGTATTATTTCCTTCAGCG
TAACTGGCGGAAACCCAGAGGCATTGACAACAGGGTTCGTAGAAGATTCAAGGGCCAGAT
CTTGATGCCCAACATTGGTTATGGAAGCAACAAAAAAACAAAGCACATGCTGCCCAGTGG
CTTCCGGAAGTTCCTGGTCCACAACGTCAAGGAGCTGGAAGTGCTGCTGATGTGCAACAA
GTGAGTTGGGTCCCACCTCTAGTTTTCAGGGATCAGAAGTTTGCATCTGTGTGAGCACTT
CTGGCAGGAACTCTACAAACTCTTGGGATGCATTTTGGCGGGGGGTGTTGTACATTCTCT
GAGGGAATCAGAAGTTGTTCCTTGCAGGATTTTAGAGAATGCTTGTTGGGGAATTCAAGG
TGTTTCCTTTGCTGAAGGGAGGAGACTTGGTCTTCTAAGTGTAGAGACCCAAGACCAGGA
AAAGACTGCTTTGTGAACACTGCAATAATAGCCACTTTCCACTACTACAATATCCTTTGG
CTGTTGTTTCCAAAATGTTGCTTTCTTTCTGAAGGTGTCAAGCAAAAGAGTTGAACTCTG
AAATATTTGAAGAGATTTATTCTGAGCCAAATATGAGTTGACCATGGCCCGTGACACAGC
CCTCGGGAGACCCTAAGAATATGTGTCCAAGGTGGGCGGGGAGCAGCTTGGTTTTACATA
TTTTAGGGAGACATGAGACATCAATCAAGTACACATAAGGCATACATTGGTTTGGTCCAG
AAAGGCGGCACTTCGAGGTTTTGGATAGATTTTCTGTTTCTCGTCGAGAATTGGTTATCA
CTAGAAAGGAATGTCTTGGCTACAGTAAGAGGTTGTGGAAACCAAGAGTGCCCTATTCAA
GGAGGGAGTGCATTCAGATGGTTGCTGGGGGCCTTTGAATTTTATTTTTGGCTTACAAGT
GGGAGAAGGTCAAACATGGACCTCAGACCTTAAGGGGCTCTTAAGTCTGTGCTGTGGTAA
GGGGTATCTTCAGGGGCAGGAGGGCTCTGGAAAGTTTGGATTAGATGGAGAACAGGAGGA
AACTTGGCAGGCAGAGAGTGCTTACACAAAGGTGTAGAGGTGAAAGCGCATGGAGGGTTT
GCAGGGCATTGGTTCCAGGTGGGTTTTATTGGTTTTTGTTTTTTAAGATGAAGTCTTGCT
CTCTTGCCGGGGCTGGAGTGCAGTGGCATGACTTCGGCTCACTGCAACCTCCACCGCCCA
GTTTCAGGCGTTTCTCCTGCCTCAACCTCCCAAGAGCTGGGATTACAGGCATGCACCACC
ATTTCTGGCTAATTTTTGTATTTTTAGTACAGATGAGGTTTCACCATGTTGGCCAGGCTG
GTTTTGAACTCATGACCTTAAGCGGTCTGCCTGCCTTAGCCTCCCAAAATGCTGGGATTA
CAGGCATGAGCTACTACGCCTGGCCTGGTTTGATTTTAGAGATAGACAGGCTCTGTGTTG
CCCTGGCTACAGTGCAGTGGCTGTTCACAGCTGTGATCATGGCACACCACAGCCCCAAAC
TCAAGATGGGCTCAAGCTGTCTTCCTATCTCAGCCTTCCTGGTAGCTAGGACCACAGGCA
CACTCCACCCCACCCAGCTAGTTCTAGGTGTTTTGAGTAAGTTAGACACTTGGTGAGCTT
TGTGTATAAAAGACTCAGTGACCTGCTTAGATCAAAACTAGGGCAGTGGAATGAAAAATT
CTCATGGGAAGTGACAGTTTATTTTCTTCACTTACTGGTAAATGAAAGCCAAAAAGCTGA
ATTTTCCTAAGTAAACTAGAAAGAACATGGAGTGTGTGTGACTAACTAGGATATTTGTGT
TTACGTTTACAAAGATAACTTTCACCTACAGTGGTTGTAGATACAAGTAATAAAAATGAA
CAAGACCAGTATTCTAACGTGGTTACCTTCCAAGATTGGAAATTTAACCAGGTGTTGAAA
TGCTGAAAATTTCTGTTAGAAAAGATGGGTGAAGGAATTAATGGTGGATACTGAAACCAC
AGTTGGCTGTATGAGTTGAACTGTAACAGGCAATACCTGTTGTATGGCCAACATGATTAC
TCAGTTGCAGTGCACATGTTGGCTAGTTGGCATATGCTCTGTAAGCGCAGCTTGGCAGTC
TTTAAGATCCATAGAAATACTCTTTGACGTTTGATCTCTAAGTTCCATTTCTGGGCATTT
GTCCTTAAGGAATGGAAAAGCAGGCAAACTAAAGCTAGTCATTGCAGCAATAACCCACTG
GAAACAACTGAAAATATAATGAGAGAATTGTAGAGTGCTGGATAAAATGTTGTGGGTCCA
TTCAAAATGACTGGAGTGCTGTAGTGTGGAAAATGCCCAAGCTGGGGGGACACATTTAAA
ATGGTGGGTACACTCTGATTGTGATTATCAAATATATAGATGGACAAGGACAGGAGGGTT
TTTTGAAAAGTAAAGACAGATGAGAAGTGTAATGTAACCTAAGTCTTTAAAACATAGAAA
CATTTAAAAATACAATTGCTTTGAATTTGAGTGGACTCATATAAAACAAGAATTGTCTGG
ATTTGCTGCCTTGCTGTTAAGGCAGGGTTCTTGAAAAGAGCTGTGTGTCCACTGCCTCAA
TCACTCCTCACAGTCCTGCTGCTTCTCTCTTTGCTGAAAATGCTTTAGGGGTGGAATGTC
TGTTCTTAACCACTGTGGGTGGCTTCATAAATCACCTCCTTACTGAAGTGTGCTTGTTAG
GCCTATTGGTTATCAAATGGGGCACAGTGTAGCTGCCTCTTAAAAAGTTGTGAGGAATGA
GTTAGAACTGGATCTGAAGTCCTCGGGTATTAGGCATGGCTATGACTGGGTGACTAAGCA
TTGTTGCGTCTCAACTTGCTTTGTATCCTCAGCAGTCAAACCAGGTGCTCTTGGCTCCAT
TCAGACTCTTGGGTTCTGCTCTTGACCATTTTGCAAAGAGTTCTGAACCTTCATGGGCAA
GGTCAAGCACCCTGTGACTGGGGGAGAACCTTTGAACCTGGAGTGTGGGCCTGGGTTCGC
CCCGGATCCCTGTCCATTGCTTGCTGTGGGCCTTGGTTTCCTTATCTGTAAAATGGAGGT
AATGCCTGGATTACAAGGCTGCTATAAGGATGAGAGGGGACAATGAGGGTACTTTTTAAT
GAAAGCATTCTTGTCACCACCAGGGAACCATAGTCAGGATTTGGGGGCATGTAGGTGTCA
TTCCACAGCCACTTACCAAGCAGCCCTCTCTTAGCTTGGTGCTGGGACTCATTGCCTCCC
CAATGGAATTTTCCAAGTGTATTGAGGGCTGTCTTGCTCCTTACCTACTTGATTCTCTTG
CAGATCTTACTGTGCCGAGATCGCTCACAATGTTTCCTCCAAGAACCGCAAAGCCATCGT
GGAAAGAGCTGCCCAACTGGCCATCAGAGTCACCAACCCCAATGCCAGGCTGCGCAGTGA
AGAAAATGAGTAGGCAGCTCATGTGCACGTTTTCTGTTTAAATAAATGTAAAAACTGCCA
TCTGGCATCTTCCTTCCCTGATTTTAAGTCTTCAGCTTCTTGGCCAACTTAGTTTGCCAC
AGAGATTGTTCTTTTGCTTAAGCCCCTTTGGCATCTCCCATTTGGAGGGGATTTGTAAAG
GACACTCAGTCCTTGAACAGGGGAATGTGGCCTCAAGTGCACAGACTAGCCTTAGTCATC
TCCAGTTGAGGCTGGGTATGAGGGGTACAGACTTGGCCCTCACACCAGGTAGGTTCTGAG
ACACTTGAAGAAGCTTGTGGCTCCCAAGCCACAAGTAGTCATTCTTAGCCTTGTTTTTGT
AAAGTTAGGTGACAAGTTATTCCATGTGATGCTTGTGAGAATTGAGAAAATATGCATGGA
AATATCCAGATGAATTTCTTACACAGATTCTTATGGGATGCCTAAATTGCATCCTGTAAC
TTCTGTCCAAAAAGAACAGGATGATGTACAAATTGCTCTTCCAGGTAATCCACCACGGTT
ACTGGAAAAGCACTTTCAGTCTCCTATAACCTTCCCACCAGCTGCTGCTTCAGGTATAAT
GTTACAGCAGTTTGCCAAGGCGGGGACCTAACTGGTGACAATTGAGCCTCTTGACTGGTA
CTCAGAATTTAGTGACACGTGGTCCTGATTTTTTTTTGGAGACGGGGTCTTGCTCTCACC
CAGGCTGGGAGTGCAGTAGCACACTGACTACAGCCTTGACCTCCCCAGGCTCAGATGATC
TTCCCACCTCAGCCTTCCAAGTAGCTGGGACTACAGATGCACACCTCCACACCTGGGTAG
TTTTTGAAGTTTTTTTGTAGAGATGGTCTAGCCATGTTGCCTAGGCTCCCGAACTCCTGA
GCTCAAGCAATCCTGCTTCAGCCTCCCAAAGTACTGGGATTACAGGCATCTTCTGTAGTA
TATAGGTCATGAGGGATATGGGATGTGGTACTTATGAGACAGAAATGCTTACAGGATGTT
TTTCTGTAACCATCCTGGTCAACTTAGCAGAAATGCTGCGCTGGGTATAATAAAGCTTTT
CTACTTCTAGTCTAGACAGGAATCTTACAGATTGTCTCCTGTTCAAAACCTAGTCATAAA
TATTTATAATACAAACTGGTCATTTTTGGGATTTTGTTTTTGAGACTCATGCTGTCATCC
CAGCTGGAGTGCAGTGGCTTGATCTTGGCTCCCTGCAACTTCTGCCTCCTGGGTTCAGGC
GATTCGATTAACAATTGGAGACGAGTCATGCAGAGAAAAGAAGTAACTTAGAATCTAATC
TTTATTAACCTGGGATATCACAGAAAATACTTGGGCCTGCCACTTGTATTTCTTTGTCCT
CAATACTGAACACTAGACACATTTGAAACCTTCCTCAGAAGGAAACAAACCAACTGGTTA
TGCCTGGGTGGTGGCATGGAAGATGCCCATTGTTGCCCAATTTGCTAATAAGTATTTTGA
AATTAGAAATGAAACATGAGGTCCAAGCCTGTCCAGTTCCCTACCCAACCCATTCCTCCT
CCCTGGAAAAAAGAAACCCGTATCATCTTCCAAATTTCTGATTCATCACTGCCACTTAAA
AATGAACCGTTTTGAATTTTAAAATGTGAATAACTCAAGTATCTTTTCTTTTGAGATGCC
CGGCCTGAGCACTAACTTCAGGCATTGCTGAATGCAGTGAAGAAACCAGAGTGGTGTCTG
CTGCCTCCTGATCTTTACAGCTGACAGCACAGCCTATTTCTAAATACTACTAGTTTGTGA
GGCAGAGACACCCTCTGAAGGAACCAGACAGACTATGGAGGGGTACAGTGTGAAGTCACT
GGAAAACTTCCTCACCCTATTTCTTTGGATGACTGTCCTGAGTTAAGGAAGGGGCCCAAC
TGTTGGCAGCCTCACAGCTTGGGCTGGGGACCTTTGAGTTGGGTCCCTGGAAAAGGCACT
GTAAGCCCTGACCAGGAGCGACAGGGCCCCCAGTGAGATGGTGGAAGGGCAAAAGTAGAG
ACCTGCGGTGGTGGGATGGGGAGGCCTCGGACTTGGGTGGGCTCCTTTCTCTTAAGCGAG
GGCCCACCTTGGTGCTGAGGGGACTAGCTGAGCTCCATTGAGTCTGTGCTGGGGGCTGAA
G
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1089, 2341..2441, 3058..3239, 6363..7640
2346..2441, 3058..3239, 6363..6489
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved