Pan_troglodytes Locus XR_020209.1
snOPY snoRNA Orthological Gene Database
Pan_troglodytes XR_020209.1
Pan_troglodytes
XR_020209.1
19
SNORD32, SNORD34, SNORD35
4181..4262, 5120..5190, 5391..5476
7510
TGGGATTATAGGCATGAGCCACCGCGCCCGGGGAAATATAGGGAACATTTCTATCATGG
CCACGTTCTCTTGGACTGCAATGCCCTAGTACATAGTAAGCGCTTGCTGGGAATGGAGTT
GTTTTGGGCATGAGTCTGTGGCCCGCCCCAAGCTAAGCTACTTTCCCTCTCCTTTCTCAG
CGGATCCTTAAACAACCCAGTGAGACAGACATCTATCATCCCATTTTACAGGGGAGGATA
CTGAGGCACACAGAGGGGAGTCACCAGCCAGAGGATGCATAGCCTGGACACAGAGGAAGT
TGGCTAGAGGCCGGTCCCTTCCTTGGGCCCCTCTCATTCCCTCCCCAGGATGGAGGCAAC
GCCAGAATCCAGCACCGGCCCCACTTACCCAACTCTGTACAAAGCCCTTGTCCCCATGAA
ATTGTATATAAATCATCCTTTTCTACCAGCTCTGGCCAGGTCTGTCTATGGATGGGTGTG
AATGGGGTAGTTTTGATTTCAGAATCTTGGTTTTTGAATTGCAATGCAATGTTTCATTCA
ATACTTGTTTTCTGAGGTCCCCTGGAGCCCCGGGCCGGCACTGGGCAATGTCAGAGCCTG
GATTTGAGTCAGAACCAGCCCAGTCGCCCCAGGTCTCCTTGGCTATGGACGAGAAGACAA
GGGACTCAGCGAGCCTGGGTGCAGGATGCCATAGGCTCCTATGGAGATAGCACAGAGGCA
GTGTGAGAGCCCGCGGGGGGCAACTCACCCAGGCAGGGAGAGCAGAGAGGCTTTCCAGAG
CCAAATGGCATTGCGATGGTGACAAGCCAGATTTGGAGGGGGTGGGGAGGGCATCCTGGG
CAAGGGACCCAGCTGAAGCAAAGGCCGACAGTCCAGAAAGTGAGAAGTTCCTCTGAGGAA
CGCTCAGTGGATTGGTGCAGCCAAGCAACTAGAAGCCATTCCTTGATCCACTCTTAGAGC
CCCTGGGGAAGACCACCTCCATCTGTTTTACAGATGGATAAACTGAGGCCCAGATAAGGC
CAAGGGTTTGTCCAGGTCACAGTGAAGTCGACCAGACACAGGAATCCAAATCTCTAAGCC
TAGAATGGGCAAGGCGCCGGGGCTCACGCCGGTAATCCCAGCACTTTGGGAGGCCGAAAC
GGGAGGATCGCTTGAGCCCAGGAGTTTGAGATCAGCCTGGCCAACATGTCAAGACTCCCC
CCGTTCCCGGGCCACAACAAAATATATATATGCCAGGCATGGTGGCGCGCCCCTGTAGTC
CAAGTTACTCGAGAGGCTGAGGCAGGAGGATCCCTTGAGCCCGGGAAGTGGAGGCTGCGG
TGAGCCACGATCGCCCCACAGCACTCTGGTGTGGACAACACAGCGAGACCCTGTCTCACA
AAATAAAGTAAGCCCGGACTGAGTGCGGAAAGGCGGGCCTGGCGGGTCTGGTCTCCCCAT
GCGGGCCACCAGAGGCCCTGCAGCCTTCAGTCGCTTGAAGGGGTAATGGCGCTTCCACTC
ACAAACATGGCGGACAGAGCGTGTGAACGAGATGAACAGCCCCTCAAAAATATGGCCGCC
TAGGCTGGACGGCCGTGCCCCAGCAGCACCGCCTCCGCGCCCCACGTGATCTCTCGCCGG
GCACAGCGCTGACCGCGGAGGTCCAACCGGAAGAATGTCCGGATTGGACATTCGGAAGAG
GGCCCGCCTTCCCTGGGGAATCTCTGCGCACGCTCAGAACGCTTCGACCAATGAAAACAC
AGGAAGCGGGCTGCGCAACCGCGTTGCGTCACTTCTGCCGCCCCTGTTTCAAGGGATAAG
AAACCCTGCGACAATACCTCCTCCTTTTCCAAGAGGCTGCCGAAGATGGCGGAGGTGCAG
GTATGTGCTCCGCGCGGGCCGGGGCGGCAAGGGGCCGGGTGGGATCCAGGCCGGAATGGG
GTCGCATCCTCTCTGTCCTCCTGCATGTTTTGCGGAGCTTAACATCCATAATGAAGCAAA
ATGGAAGTCTTTTGGGATAAGGGGAATCTGTAGGAAATGCCGCGGCTCTCTTTAGGCCTA
GGGTTGGCTACAATGTGGCATTTCCTTCTCGAGGCGAGGGTGATAGAGCTTCCAGCACAG
GACAGGTATTTTACAACTAGATTTTGCTTACCTGGAACTCGGGTAGTGGGTGGGGGCCCT
GGGGTAGAGTCTTGGCCGAATTGGACCGTTGTGTGTCCTCAGCGATGAGGAACACGCGGA
AGTGTGGCTGGGCGGTCTCGGGGCAATGAGAAACTGAGTTTTGGCCAAAATGGAAGGTAT
TTTTATCCCGCTCAGTGCGCGGGCTACTTTGATTTCACGTGGAGGTGTTAATCGGGGTCC
CTTGCAGCTCCGGTTCTTTTAATTCTCAATGCCTTTCTGCGGGGGGTCGAGAGCTGTTGG
CTGCGGGGCACTCGGGAATGAACTCGTTTTCCGTCGTTTTGGGGATTGGCGATTGTCCTG
AGGCTTGTTACTGGAAGTCGAGAGGTGTGATGAATGGTTCCACAAGGATGGGACATCTTT
TGGGCCTGACACCTGGGGGCCCTTTCCCTGGCTCCTGGTGTAGCTACTTAAGTATAAAGG
AGGGGTTGGCCCTGGAAAGGTTTCTTTGTGAGTAGTCTGTTGGGGCGGGTGACATTTCAG
AGCCAGGCCGATCTAGGCAAGTTGTGTTCACCAAGCATGTGTCTTTGTGCCTAGCACAGT
TTGCAATGTTTTGCGTAGTTCAGTTAACCATATTCCTGAGGCAGATATTGGTATCCTTAT
TTTACAGAGGAGGAAATTAAATTGGAATTGGTGATTTTGGGCCAAGGTCACGACTTCAGG
AAGTCTGTCTGGATTTTAGAGTCTTTGTACCAACGCTTACAAAGCATGTGTAACAACCAG
TGTGTGCTTCATGCTTTTGCATTAAAACAATGAGGATTTCTACTTTTAGTGTTTTTTCTG
AGACAGAGTCTCGCTGTGACACCCAGGCTGGAGTGCAATGGTGCGATCTTGGCTCATTGC
AACCTCTGCTTCCCAGGTTCAAGTGATTCTCCTGCCTCAGCTTCCCGAGTAGCTGGGACT
GCAGGTGCCTGCCACGACGCTTGGCTAATTTTTGTGTTTTTAGTAGAGACAGGGTTTCAC
CATATTGGCCAGGATGGTCTCGAACTCCTGACCTCAACTGATCTGCCCGCCTAGGCATCT
CAAAGTGCTGGGATTACAGGCGTGAGCCCCTGCACCCGGCCAGGATTTCTACTCTGGAGG
AAGCTGAGGTTCGGTGCCTGAGCAGTTTAGCGGGGAAAGCAGAGTGCTCTATAGCAGAGC
TAGCATGGGCTTTTGACTACTCTGCCTAATCTCATCCCACCTGAAATTCGGTTTTCTTCC
AAATTAAATTTGTGGTAGAAACATCCTATACATTAGAAGAGAATTAGATTGTGTTAACAT
CCTACAATTGATTGGCCACAGTGGCTCAAGTCTGTAATCCGAGCATTTTGGAAGGCTGAG
GCACACGGTTCACTTGAGGCGAGGAGTACAAGAGCAGCCTAGGCAACATGGCAAAACCCT
GACTCAACAAAAAAAAAAGTACAAAAATTAGCTGCGTGTGGTGGTGCGCGCCTGTAGTCC
CAGCTACTCATGAGGCTGAGGTGGGAGGATAGCTTGATCCTGGGAGGTCACAGGATCACA
GGACAGCCTGTGCAACAGCGAGACCCTGTCTCAAAACCAAATCCTACAGTTTATTAGTTA
CAAGGTCTTGTAACTGGGTAGTCAGTGGGCAGAGCCTTGCTGGTCTTCCTTCAAATCCAA
TTGCTTTGCAAAATACAATCTGAGCATAAAATACTCATAGAAGAACTCAGATATGAGGGG
AGTTTGGGCCTCTTAAACTGCACACTCACTGATCCTGAGGCAGCCTTGCTTTCTCAGTCC
CTGTTCCTCATCTGTAGAACGGGGCTCCGTGCATAGTTCCCAGCTCTGATGGCTGGGTGC
AAGGCACGCTGTTGGCACAGTAGGACAAAAGAAGGGAATGCTTGCTTGTGAGGACAATCA
AAGGCTGTCCTTGTCTCTGAGTCCTTCTGCCCTTGTCTCCCACAGGTCCTGGTGCTTGAT
GGTCGAGGCCATCTCCTGGGCCGCCTGGCGGCCATCGTGGCTAAACAGGTACTGCTGGGT
AAGTCGCTGCTCGCGGCCCCTCTGTCATGGGCCCCCGCTGGAGGTCAGTGATGAGCAACA
TTCACCATCTTTCGTTTGAGTCTCACGGCCATGAGATCAACCCCATGCACCGCTCTGAGA
CCTGCCAGCCACTCTTCCCCAGGGTTGGGGACTCCAGGCTCAAGAAGTAATTATGTATTA
GGCTAGTTTTTCATTTTAACATGAACTTAGCTCTGGCGAGTACTGCGCTGTGTCTGGAGG
GTTGACTGCATAGGCAATGGTGGGACCCTCAGGCGGCTCGGCCCTGCTAAGCCTTTCCCT
CCCTCTAGGCCGGAAGGTGGTGGTCGTACGCTGTGAAGGCATCAACATTTCTGGCAATTT
CTACAGAAACAAGTGTAAGTTAGGACCTGGGAGGAACACTGGAGAGGGTCTCCCTGTGGG
GTGTTGAGGCTCTGAAAGCAATTGCAGCCGTGTTGGGAGAGGCTACTTGGGGTTTCTGAG
AAGGCCCTTGGAAGTGGGGTTTTGAGGGTGCTGGTAGACTGGGCAGGCCTCACACTCTCC
CCTCTCCCTAGTGAAGTACCTGGCTTTCCTCCGCAAGCGGATGAACACCAACCCTTCCCG
AGGCCCCTACCACTTCCGGGCCCCCAGCCGCATCTTCTGGCGGACCGTGCGAGGTGAGCA
GAGCGTGGGGACTGCAGGTGGTGACGGGCAGGCGGCCGGTGATGAGAACTTCTCCCACTC
ACATTCGAGTTTCCCGACCATGAGATGACTCCACATGCACTACCATCTGAGGCCACCCCA
TGGGCCCACCTCAGTGGGGAGGGTGGGCGTCCTTATGAGGCCCTCTGACTGGGCCTGCTA
TCTGTCACCCAACAGGTATGCTGCCCCACAAAACCAAGCGAGGCCAGGCCGCTCTGGACC
GTCTCAAGGTGTTTGACGGCATCCCACCGCCCTACGACAAGGTGAGCTGTGCCAAACCCC
ACAGGCAGCGGCCTTACCTGTGGCGTCTGTGATGTTCCGCAACTACCTACATTGTTTGAT
CCTCATGAAAGCAGCACTGGCTGAGACGCCAGTCCAGCCGACCTCCTTCCCTGTCTGTCC
CTCCCGGGCTCTTAAGCCCCTCTCTTTCTCTAACAGAAAAAGCGGATGGTGGTTCCTGCT
GCCCTCAAGGTCGTGCGTCTGAAGCCTACAAGAAAGGTGAGTCCCAGCTTATGCTGCACC
ATCTACTTGGGAGATTTCAGGCCTGCTGAGGGACCTGGGGACCCGGAGCCTGGCAGATGA
TGTCCTTATCTCACGATGGTCTGCGGATGTCCCTGCGGGAATGGCGACAATGCCAATGGC
TTAGCTGATGCCAGGAGGCTTGGGTGGGTGCTTTTCTAACAGGCCTTCAGAGAACAGTTG
CATTATGATATGCCCAGCTGTCAGTCACCTCCCAGCTCTCACCAGCTCCGGCTCTTCAGG
GTGTGGGGGCTTAGATATCCTTACAACTTCATTTGTTCACCGCCCCCGCAGTTTGCCTAT
CTGGGGCGCCTGGCTCACGAGGTTGGCTGGAAGTACCAGGCAGTGACAGCCACCCTGGAG
GAGAAGAGGAAAGAGAAAGCCAAGATCCACTACCGGAAGAAGAAACAGCTCATGGTGAGG
CCAGGGGCTGGTGCTGAGGGGGGCATCTCACTCCTGGACAGGCCTGGCAGGTGCCTTGCC
CACAGAGTACTCTTAACTGGCAAAGGGCCAGCCGGGGTTGGGGTGGGATGCAGTCCGTGT
AATGAGGGCAATGCAACCCCTCCTGACCACCACCACCTGCACTTATTCTTGGCAGAGGCT
ACGGAAACAGGCCGAGAAGAACGTGGAGAAGAAAATTGACAAATACACAGAGGTCCTCAA
GACCCACGGACTCCTGGTCTGAGCCCAATAAAGACTGTTAATTCCTCATGCGTTGCCTGC
CCTTCCTCCATTGTCGCCCTGGAATGTACGGGACCCAGGGGCAGCAGCAGTCCAGGTGCC
ACAGGCAGCCTGGGACATAGGAAGCTGGGAGCAAGGAAAGGGTCTTAGTCACTGCCTCCT
GAAGTTGCTTGAAAGCACTTGGAGAATTGTGCAGGTGTCATTTATCTATGACCAATAGGA
AGAGCAACCAGTTACTATGAGTGAAAGGGAGCCAGAAGACTGATTGGAGGGCCCTATCTT
GTGAGTGGGGCATCTGTTGGACTTTCCACCTGGTCATATACTCTGCAGCTGTTAGAATGT
GCAAGCACTTGGGGACAGCATGAGCTTGCTGTTGTACACAGGGTATTTCTAGAAGCAGAA
ATAGACTGGGAAGATGCACAACCAAGGGGTTACAGGCATCACCCGTGCTCCTCACCTGTA
TTTTGTAATCAGAAATAAATTGCTTTTAAAGAAATCTGGCGTCTTTGCACTGTGTCTGCT
GTGGAGGCAGGCCCCTGGCAAATGGGGGGTGAGGAGCTTGAAGAGGGTAGAATGGGCTGT
GCTAATATACAGAATATATGTAACTTGCTGTAAATTGAATGATCCTTTATAGACACCGTT
TACAAACCAAATACATAAAATGTGGCCAGCAGTGCCTGGTGCTTCCTAGTTAATGTAAAG
CTGTCTCATTCTAATTCAGCTGCAAAGTATGGACCCATGCCCTGCTGCCAGGCTGCTGTA
GTCCCGGCAGTCTGTAGAGACTAGCATTTTGCAAATGATAAGCACTAGAATAACAGATAA
CGCTAGGCTTTATGCACTAAGAGAACCCATTAGATCTGCCAGTCTGAATCCCAGAAAGGG
CACTGATACAGAGCATTTAGTACTAGGTAGCAATTTCATAAAATGTCCCTGGTCAAAGCT
TGCTGGGGCAGGCCCCGTTCCCATTTTACTGATGTCTAGCAGTCATGTTCGGTAATACGT
CATACCCAGGTCTCCACGCTAAACAGCCTGAACACTAAAAGTAAACATGCTGTGAAGTAA
AGGAAGCTAGATTCATGCTGTCCTTGCGGTTGGATGCCAAGATTCAGGAGTAACTGTTTG
GTACTTGTATACTTACATGTACAACCTTACCCCAGAGAAAGATGAGTGGACAGTGATGTG
CATTGTGTTGATGGCAGATTATAACTTGCCACACCATTCCATCAGGGGCTTATTAACCTT
TCCAGAAAAGTCTGAAGAGACCACAGTGGCTTGTGTTTTCCCTGAGAATCAGTGAACATG
GGTGGTGCCTACCCCTGCCAGAGTCCCCATATGGATTCTCATCCACCAGAGAAGCCGACT
CCAGAAATAACCAGACTTAGAGCATAATCTTCAATTTCACCAATTCCATGTGAAACGGCA
CAATTATCCTCCAAAAGCATGATCCATTAGCAAATGGCAATGTGGGCTTTATAAAAATTT
TTAAGACTGAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1012, 4065..4137, 4448..4513, 4691..4792, 4995..5080, 5256..5315, 5631..5753, 5935..6510
1001..1012, 4065..4137, 4448..4513, 4691..4792, 4995..5080, 5256..5315, 5631..5753, 5935..6018
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved