Pan_troglodytes Locus RPL18A
snOPY snoRNA Orthological Gene Database
Pan_troglodytes RPL18A
Pan_troglodytes
RPL18A
19
SNORA68
3664..3796
5339
CACCCGCCTCGGCCTCCCAAAGTGCTGGGATGACAGGCGTGAGCCACCGCGCCTGGTCT
TTTTTTTTTTTTTTTTTTTTGAGACAGAGTCTCACTCTGTCGCCCAGGCTGGAGTACAGT
GGCGCAATCTCGGCTCACTGCAACCTCTGGCTCCTGGGTTCAAACGATTCTCATGCCTCA
GCCTCCTGCCTCTTTCCTCTTAATTTTACTTCATAGCCTTGTCATCAGGGAGTTGTTTGC
GGCTGTTTCTTTTTTCATATCTGGTCCCCGTCCTCATCCCCAGGAGGGCTTCTTTCTGCC
CGAGCAAACTGCTAAGTCCAAGCCCCTCAAAGTGGGCGGCTGGATCTTGATCCATTCCCC
GGCTCTCCGCGCGCCCTCCCCCAACCCCCGCTCCCTCAGGTTCTTATGAACTGGAGGCAG
ACAGACAGAGTTTGAATCCCAGCTACTACGAAACACAAATCGGACCCCAAATTAACAAAA
ACAGCATTCCAGCGCTTATTCAATATTCGTGCTGCAACATCGCTAGGAGAAAAATATATT
ATTTGTATTCCCATTTTACAGATACCCTCAGGTATCTGGTGGAGACCTCCGTAACACACC
TCCCCGGAGGATGAGGCCCCGAGTGTGAAGCATCGGGATCTCATGGTAAACACCGCAGCC
ACCCGAGGTCCGGTTCAATGCTTAGGCATCCTGCAGGCGGCGCGCGCCGCCGCCCCCAGT
TGCAGCCGGGACTGGCGGAGTGCCTACAACTCCCGATGTGCCGCGCGCGCCGACGCTCCG
TTACGGTCGTGGTGGAACAGGTGGAGCTTGCCTCGTTGCCTTCTGGGAAACGAAGTCTCG
CTGAAGAGAGGTCGAACTTTGAGTAGCAGGTGGATCCGTAGCCAATGAAGACGCGGATCG
CTTTGAGTGCGGGGCAGAGGAGCCAATGGACGTGCGGCATTGGGAGGGCGGGTCTTCCGG
TAGTGAAGGCCTGGTGAACGGCTGCGCGAAAGAGGACACTTCCTTTTGCGGGTGGCGGCG
AAGGCGGAGAGCACGCCATGAAGGCCTCGGGCACGGTAAGGCGGGCGCGGCGCGGCAGGG
GGCCAAGGGATGGGGCACGGGCCCCATCAGGGGCCTGCATAGGTGGCGTGGGTCGGGTTG
GTGCCGCGCGCTTCTGTTTGGGCCCCCCTTGGCCGCGCACCGGCTTCTCTTGTTGCACCC
AACATGGCGGCCATGGTGGGAGCCGCGTGGAGAGAGCGATGCGTGACCTGGGCCAGCTCA
GGGATCGCGGGGGCCCAAGGACTCCGGGTCTTCTTCCCGGGGGAAGGAATAAGTCGCGCA
GCATAGAGGCCCTAGCCCCGGCACCTCGTCGAGCCGCCAAGTTTCTGTTTTCCTTTCTGC
AGCGTGGACGTGGCGGTAGAGCAATAGTGTTTTCTTTCTGCCGGAATGGCTGTGAGAAGC
AGATGAAAATTGCTAACAGTGAGCCGAAACGGGGAGCGCGAGGCTTAACGCTGTGATACA
TACTGGATAGAATCAAACGGCTCTATGGCGCAGAGATAGGAGAACCTGGACTCCCATGGA
GTGGGTGTATTATGTCCAGATCTCCAGCTTCGGTTTCCTTACTGTCAAAGGGGCGGGCCC
CATTGTTCCCTTCCTGAACGTGTGCCGAGGCCGGTGGGTCAGGTTCACAGTAAAAGTAGG
AACTGCGATAATTTGTGACTATTTTTCATTGATACTAGTGAAAAGCTGGCGAGTCAGTTT
CAGAGGTGGTTTCTTTGTGCCATATCACAGAGCCTGGACTTGACTAAAGATTCTCACCTC
TGCATCTGTAAACCGGGAGTCTTCCCTGGGCCAAACGTTTGGATTGCAGTTGGGAAAACG
GAGGCAGCCGCAGCTCGCGTGGCGACAGTGCAGGGATCCCAGGGCTGGGGAGAGACCTGA
GGTCTTGTCCTAGTTCTGCCTGGAATGGGCTGTGAGATCCCATGCTGTTCACTGGGCCTC
AGGGTGAAAGAAGATGTTGGCTGGATGTTTTGAGGTGCAGAGTGGCTGTTTGACGGCGAC
TGCAAAGCAATTCAGGACTGCAGCATGAAGAAAGGAGGCTGTGGGCCTAAGCCACAGCTT
TCCTGGTCTGAAACCCTTAGCCCAGGCAAAGGAGAGGCAGGCAACTCAATTAATCTTCCC
TGGAGACCTCCCTCTCCTCAGTTCATTTTGTGTATAAAGTTGTGGTCGGGAGTGTGACCC
ACAGTCACCAAGAATCCACATGGAGGCCCTAGGGTGGCCCTGCCTCCTGCTTCCCGAATC
TGTGGTTACTAGGTGCAGGAAAGGGAGTGAGGTGGATCTCCACAGTTGCCTCTGGGTGCT
GGCCTTAACCTCACTCCTGTTTCCTTTCAGCTACGAGAGTACAAGGTAGTGGGTCGCTGC
CTGCCCACCCCCAAATGCCACACGCCGCCCCTCTACCGCATGCGAATCTTTGCGCCTAAT
CATGTCGTCGCCAAGTCCCGCTTCTGGTACTTTGTATCTCAGTTAAAGAAGATGAAGAAG
TCTTCAGGGGAGATTGTCTACTGTGGGCAGGTATGGAGAGGCCGGGGCTACGTGGGGTCT
GGAGTGGATTTGCGCCTCTTGGGACATCGTGCATCTCAAGAATTAATCAGACATCGACCG
GGTGCGGTAGCTCACACCTGTAATCCCATCACGTCAGACATCAGAGCCCCGGGTTGTGTT
TCTGCCTGGGTCACGGGACTGGAGCAGAGCTTATGTGCCATTTCCCTGATTAGAAAGCCA
GGGACCCAGGGAGCGGGTGGGTGGCATGGTGGGACACCTTGGTTGGTGCTGTCTTCCCTG
GGCCCTGTGTGTTAAGTGAGGAGAGGTGATGGCTATCTGGTCAGTGGGTGGTAGCTAGGT
TGGCCCAGACAGGTTCCAGGAGACTTGAGTTCAGGAACTGCATCTGGGGCTGGGTTGGTG
TCCGTGGCAGAAGCCTGGACTTCAAGCTGTTGCCATGGGAAGTTCCCTTACCTCACGCTC
CCTGAGGGTGCCTGAAGGTAGGTGGGGCTGGGGAACTGAGGCACAAGAGTCTGGCCATAG
AGTAGGCCTGGAGCCTGGGGTGTGCTTTAGAGGCCGAGGGCTCAGTGAGGATGGGGCTAG
GGCACATCGGCTTGCTGCTCTCACATCTCCCTGTGGCCTCTCCTTGGCAGGTGTTTGAGA
AGTCCCCCCTGCGGGTGAAGAACTTCGGGATCTGGCTGCGCTATGACTCCCGGAGCGGCA
CCCACAACATGTACCGGGAATACCGGGACCTGACCACCGCAGGCGCTGTCACCCAGTGCT
GTAAGCCGCCTGTCCCGCCTTCAGCTTTTTAGACCCTCCTTGACTCCCTCACACTGAGGC
AGGGCAAATGCCAGAGGTTCCCAGTGCAGGAGAGTCTCAGGACTGGTGGCGGGGCACAGG
AAGACGAGAGGATGCCCTAGGCCCCAGATGGCGCTTTTCTGAGAGCCCTGCCAGGCTCGG
TTGTAAATCACATCGCATCTGGAAACTCCCTTTTTGGGTCTGCACCTTGTTTAGACTGGG
ATCCACATCACCACTGTTTTCTGGGACCTGCTTAGAACCGAATTGAACCCCTGCCTGGTG
TTGGGAGCTGGCACCTTTTCCCTGGCTCACCTGCCAGGGTCTGTGAGACCCCCACACCTC
CCTGATTGCACCTAAACCCAAGAATCACTGTTTCTTATAGCGGTGGTTTAAACAGAGGTG
CAAACAGCAAGTGGATCTCGTCGCCTTTGGGGGGCTGTGGCCGTGCCCCTCAAAGTGAAT
TTGGAGGTTCCACAACTCTAGTGGCCAGTGACTGCAGGGACCCAGGCCTTGGGCTATCTC
GCTTCCCCACCACCACCTTCCCGTGAGCCCCGAGCCCTCAGGCAGTTGCTGTGACCAACA
GGATGTGTCAGGTCATTGGGCAGGCACTCAGGAGGTTTGCTGAATGCCCAGAGCCCAGGC
AACACCGTCACCCTGGCCCCACTCCTTTCCACAGACCGAGACATGGGTGCCCGGCACCGC
GCCCGAGCCCACTCCATTCAGATCATGAAGGTGGAGGAGATCGCGGCCAGCAAGTGCCGC
CGGCCGGCTGTCAAGCAGTTCCACGTGAGTGCCCTGGGGGACTCCCCTGGAGGGAAGTGC
CTGCTCTGACGCAGGAGCCCAGTGGGGGGCGGCTACACCTTGGTGGCCCCACAGGATGGG
GTGTTAAGAGGCTTCCAACCCCCTCAACATGCCTCCCTTCCTCACAGGACTCCAAGATCA
AGTTCCCGCTGCCCCACCGGGTCCTGCGCCGTCAGCACAAGCCACGCTTCACCACCAAGA
GGCCCAACACCTTCTTCTAGGTGCAGGGCCCTCGCCCGGGTGTGCCCCAAATAAACTCAG
GAACGCCCCGGTGCTCGCCGCGTGTTTTCTTTGCACACTGCAGAGCTCAAAGGGGTGCTA
TGAGAGGCCGGCCCAGTCACCTCCTGGGGTGCAGCTGAGCTGCTATTTCTCTGTCCTGGG
AGGGGTCTTCAGTGCAAACAAACAAACCCTCACATCCTCCTGTCCTGGAGTGGGCCCTCC
AGGTGCCCCCACCCCTGAGCTCCCTCTTGCTTGGTCAGTTCTCAGCCCTACTGGCAGCCC
TGGGCTATGAGCTGCAGGGGTACTGTCTGTCCTGGGCCCTAAATCTGTCCCAACTGCTTT
GTGAGACACAGGCCTCCCAGGCTCCCCTGCTGAGTCTGGACCAGGGAGAATCTCCGTAGA
TAGTGGGGTTGGCGTTCACTCCCTGGGGATTCCCCTAAGTCTCGTTCCCAAAGTTCTCAG
AGTAGACACAAGAGGGCACCCGAGGGGCGCTCTCTGCTGCTTGGGGGCTGTTTCCCTTTC
ACTGGTTGGGGGCCTCTTAGATGACGCCCTCATCTTGCCCAAGGAGGTCAAGGACTCACC
ACAGGTACTCATCTCTGGGAAACTGCTTCAGGCCTGGAAAATTCCAGGCATGACACTAAT
CCCACCCTGGCTGAGTCCTTCTGTCAGGTGGAGGCTAAGCTGGCATTGGAGAAGCTTGAG
ACACAGCCAAGAGCTCAGGCTCTGGGAGCCTCCCATCCTTTGTTGCGTGACCTTGGGCAG
CCCTGTTCTGGGCCAGCGGCCCTTCTGGGGCTTGCTGTCTTGATCTCAACATCGGGTTCC
ACATTGATGTGGGAAGTGACGCTGTGCAGTTGCTGGGGGCAGCCTATGGGGCCCTCCTTT
GTCCCAGAGAGCCCAGGATCAGGAGGAAGCCAGGACTAGGTAGTAGTTACGGCTTTTTGA
AACAGGGTCTTCCTCTGTTGCCCTGGCTGGAGTGCAGTGGAGAGATCATGGCTTACTGTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1054, 2370..2549, 3170..3299, 3994..4103, 4247..4381
1037..1054, 2370..2549, 3170..3299, 3994..4103, 4247..4339
NC_006486
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved