Pan_troglodytes Locus Q8HZC2_PANTR
snOPY snoRNA Orthological Gene Database
Pan_troglodytes Q8HZC2_PANTR
Pan_troglodytes
Q8HZC2_PANTR
2a
SNORA42
2534..2669
5191
AAAAGTGTCCCCAATTCAAGTCCAGTGCCTCCCTGGTGCGGGCATTCCAGCGTGGCCTG
GAGTGAGTGGCAGTCCACCCCCAGAGGCGTCCCCTGGGCGCTCCTAGGGACTCGAATTTC
CCACGCGGCTTTTTGCTTTATGTATTCACTGTTTAGACGTTTTCGGTCAAAGCATTTTGG
GACTTCCGTAACTCTCAGAGCGCGCCAGGGAGCCGCCCTTAAAGATACCTAGTTACTGAT
GAGTTCCATCCGGTAAAGCAGAGGGTAGTGGGCGGCTTGGAGACTCAGGATCCGGCTCCC
CTCACGCTCCTGGCTGAGTCCCTGGCTTCACAGGGGAAACTACCTCCGCAGGCCAGGACC
CATCTAGTTACAGGATACCTCGATGTTACAAAGACGAGGCTTCCAGCGCGGGGGCGTGGA
GGCGGCTGCTAGCCCTGCCCGCAGCGTGCTGGCGACCCCCGGGATGCCCCTTCCCTCCCG
CGCCTCTGCTCCCTAGCTGGTGGGAGCAGAGCGGCACCGGGATCACTTCCAGGTCCCTTG
CACCGGAGCAATGGGCGGCAGCAGGGTCCGGAGTAGGCCCGGCGGGGCCCACGTGGCCAG
CACATCGGTCCTCCGCTCGCGATTTCCCTTTTCCGCTCTCGGGCACGAGGTACTGAACGC
CAGGTGTAAGCACAGCTGTGCAGCTACAGGCTCTGCCGTTCAGCTGCCGCGGGCGGGGGC
CGGGGCCTGCGGCGTCGTGCGCGTGCGCGGACCAGTTCCAGGCGGGCGCGACCGCCGCAG
GGCGGGGCGGGGCGAGGCGGCCGCAGGGCGGGGAGGGCGGGGCGCGAAGCCGGGGGCGGG
GGCCACGCGTGGGGCAGGCGGTGCTCGGCTCGGCTGACGTCGGCCCGCCGGCGCCCCACC
AGCTCCGCGCGGGCCCGGGTTGGCCACCGCCGGGCCCCCGCCCCTCCCCCGGCGGTGTTC
CGGCCGGAACCGATCGTGGCTGGTTTGAGCTGGTGCGTCTCATGGCGACCCGCCGGTGCT
ATAANTGGGAAGCGGCGCGCCGTGGGGGTTTGTCATCCCTCCTGTAGCCGCCGCCGCCGC
CGCCCGCCGCCCCTCTGCCAGCAGTCCGGCGCCACCTCGGGCCGGCGTCTCCGGCGGGCG
GGAGCCAGGCGCTGACGGGCGCGGCGGGGGCGGCCGAGCGCTCCTGCGGCTGCGACTCAG
GCTCCGGCGTCTGCGCTTCCCCATGGGGCCGGCCTGCGGCGCCTGGGCGCTCTGAGGTGA
GGGACTCCCCGGCCGCGGAGGAAGGGAGGGAGCGAGGGCGGGAGCCGGGGCGGGCTGCGG
GCCCCGGGTCCCGGGCACCGGGCACGTGTGCGGCGCGCCTCGCCGGCCTGCGGAGACACG
TGGTCGCCGAGCGGGCCACGACCTTGAGGCGCCGCTTCCTCCCGGCCCGGGGTTCTCCCG
CGGCTGGATAAGGGTGATTCGGGCGCCTCGTTCTGCCCCCGTCTTCACAGCTCGGGGCTG
GAGGGGCCTAGGGGAGACCCACCCGGAGACCCTGCGGCCCCGCGCCGGCCTCTTTCCCAA
CCCGTCGGCGGCCGCGCGCTGGCCGGGGAGCCGTTGGGGAGGCCCTGGCGGCCGCGCAGC
AGGTGCAGGGGCGCAGAGCCCGGGCTCGCCTTGGTACAGACGAGCGGGCCCCGGCCTTGG
CGCCTTCAGTTTCCTTCCAGTTTTTATTTTCGCTGTGTCTACAGAGCAGATGACACCAAT
TTGGAAACCCGCGAGAGTGGGTAGAGCTAAGATAGTCTTGCTGTAGTAGCTGTGATATTA
GATGCTCGGCCATGACTTAGAGGTGTTTATTTAAGGACTGTGAATGACTCGGTGATTTCG
GAAAAGCTTGGCTTAGATGAACGGACATACACAGGGGAGACAGCCCTAAGGTTTGCAGAA
AAGGCTGATTGTGCTGTTTGCGAAGTCGAAATAATTGGTGAAAGTGTAGAAGGCAGAACC
TCTCAGGAATGTCTGGGGAGGACAAAGAATGTGTTGGCTGACTTTGTTTAAACATAAAAT
TGGGCAGACTTTAATTGATTTGTGAAATTTTTTTCAAAGTTTGTTTGAATTAGCCCCTAT
CTCTTCTAACATTATCCTCTTGTGCTAATTGATTGACCATTTTAAGTAACTTAGCTGTTA
CAGAAAGACCGAAAGGTGTTCTTCAGTAAAGTATATTTAAGTAAGTTACTTAAGTAACGC
CTTAAAAGATACAGAAAAGCAAAAAAGTGTTGGCGTATTAAAAAGAAATCAAAACTTTCC
AAGTTTAGGCCTGAACACTGCCTTAAAAATATTTAATAAGGCCTTAAATGACCCAGTTCG
TGACTGCATGAGCCTATTTATTATTAAATTGTAAATATTCTTCATATAAACAAAAATATA
TAACCATGTCTGTAACAAAAATGGTTTTGCTAGCGTTGTTACTCTCTTCCCTTCTCCGAG
GGGTGATTTAGGCAACTTCGGAGGTTGACAATGCCAAGCAGTCACAATAGATAGAGCTTT
AAAGCAAATTCTATGCATGGGTTTGGATTTATGACAGGCCCGTCACCCTGGGCCTGTCAT
AGTACCCCATGCCAGAGCAAACTGTGTCCCCGAACCATTGCCTGGCCTCTGTGCCCGTAG
GCTGCTGGCACTGAAGTGGGTTGCACAGTGGAAAAGAAGAAAGCTCTACCTGGCAGAAAT
TTTTAAAGGTTAAAATAAATAATTTTAAGAAAGCTGGTTCACAAGGTGCCACATTTGATG
AAAGCAAAATACAGTGGCTTTTATTGTTACTAGAGTGATGTTCTTGCTTGTTTTTCTTAC
TGGTGAAGTTAGCCCCAAATTATTCTCATAGCTAAGCAAATACGAGAGTGACTGTAAGGA
CAGTTGGCATTCCCGGAATTGCTAAACTTGGTAGGCAACGCTGGTTTAAGAATACTGAGT
TCTAGCCGGGCGTGGTGGCTCACGCCTGTAATCCCAACACTTTGGGAGGCTGAGGCAGGC
GGATCACCTGAGGTCGGGAGTTGGAGACCAGCCTGACTAACATGGAGAAATCCCATCTCC
AGTAAAAATATAAAATTAGCCAGGCCCCGGGTGTGGTGGCACATGCCGGTAATCCCAGCT
ACTCGGGAGACTGAGGCAGGAGAATCGCTTGAACCCAGGAGGCGGAGGTTGAGGTGAGCC
GAGATCATGCCATTGCACTCCAGCCTGGGCAACAAGAGTAAAACTCTGTCTCAAAAAAAA
AAAAAAATACTGAATTCTGATCAGGTAACAGCAACTGTAATACAATGTGATAAGTTGACT
TGAAGATTACAGTTTTTAAGAAGTATATACCCAGCTAATACATGAAAATTAACTCGTAAA
ATCTCAAATGCTCCAGACATTTCCATGATGCCTGTTGGTCAGTAAAAATCATTCTAAGAC
TTAGTGGAAGTAGGAAATGTTTGTATGGCTGTGTATAAAGGCTATAATGTAATCCCAGCA
CTTTGGAAGACCGAGGGGGGTGGATCACCTGGGGTCAGGAGTTTGAGACCCGCCTGGACA
ACGTGGTGAAATCCTGTCTCTACTAAAAACACAAAAATTAGCCGGGCATGGTGACAGGCG
CCTGTAATCCCGGCTGCTGGGGAGGCTGAGACAGGAGAATCGCTTGAACCCGGGAGGCAG
AGGTTGCCGTGAGCCAAGATTGCACCGCTGCACTCCAGCCTGGGTGACAGCGTGAGACTC
TGTCTCAAAAAAAATAAAAAAGTCTATAATGCTATTTTAAGTTTCTAAGGAACTGAAACT
GCTCTGAAATAAATCAGACCATTATAAGACTTTTTTCCATATCAGTGAGCTAAGTGCAGA
TAAGCTTCTGAAACTTGCATGCTAGATTTTTTTGGTACAAATATTTGAAATGCTTAGTGT
GCTGCCTTGGAAAAACCTGGTATTTTTTGTGGTGTCCTTATACTGCCAAGGTTTATGGAA
TCATGTACCTTATGCCTAGTAATAATCAGGATGACCAGGCCAGTGAGTGGTTCATATCCG
GGGCATGATTAGCTCTGCGTGTGCTCGGCCAGTGCCCCATCTTCAACTCGATGTGTTCCT
AAGGTAGACAGCAAATTCCCTATTTTATTTCTCAGATTGTCACTGCTGTTCCAAGGGCAC
ACGCAGAGGGATTTGGAATTCCTGGAGAGTTGCCTTTGTGAGAAGCTGGAAATATTTCTT
TCAATTCCATCTCTTAGTTTTCCATGTAAGTATTCAGTTTACATTTATGTTGCAGGTTAA
TCTTAAGAATTGTATTGCTAAGGCTTCTAAGTGAATTTCTCCACTCTATTTGCATTTTGT
TGCATTTCAGAGGAACATCAAGAAATCATGAACAACTTTGGTAATGAAGAGTTTGACTGC
CACTTCCTCGATGAAGGTTTTACTGCCAAGGACATTCTGGACCAGAAAATTCATGAAGTT
TCTTCTTCTGTAAGTATATGAGGCCCATGCTGGCAGTGCAGCTGGGAGTGCCAGGCAAGT
GGAAAACTTCGGCAGGGTCTAAGGAAGAGCAGTGAGGCTTACGTGTCTTGTTACGGAATG
TAGAAGTTAATTCACTGGTGGTAAATTAATAGTGATAATGGTGATACTCATATCAGTGGC
TAGACTCAAAAGAGCAGGATTCATTGTGACTGATGGGAATGAAGGTCGCTGGCTGCTGGT
GTGGTGTGTGGTGAGGCTGCTAGTGAGTCACCTGTGACCACTCTTGTTTCAGGATGATAA
GGATGCCTTCTATGTGGCAGACCTGGGAGACATTCTAAAGAAACATCTGAGGTGGTTAAA
AGCTCTCCCTCGTGTCACCCCCTTTTATGCAGTCAAATGTAATGATAGCAAAGCCATCGT
GAAGACCCTTGCTGCTATCGGGACAGGATTTGACTGTGCTAGCAAGGTAAGCGATAGCAG
CAGGCCTCAAAAGTGTTGTATAAAATGGGCCTGGTATTCCCCACGAGGCAGATACAAGTT
GTGTTTTTTGGGCAATAAATGCTCACTAAAGGCAAATGGGGCGGCGGGGTACATGACAAC
TTCCCATGCTTTTCTGTTTATTCCACGTGTTAAGCCACGTATGGATAGCATGACACCACT
CTTCTTTTTCAGACTGAAATACAGTTGGTGCAGAGTCTGGGGGTGCTTCCAGAGAGGATT
ATCTATGCAAATCCTTGTAAACAAGTATCTCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1077, 3437..3936, 4146..4191
1012..1077, 3437..3936, 4146..4191
NC_006469
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved