Pan_troglodytes Locus IF4A1_PANTR
snOPY snoRNA Orthological Gene Database
Pan_troglodytes IF4A1_PANTR
Pan_troglodytes
IF4A1_PANTR
17
SNORA67
12744..12880
14799
AAAGGGTAGAGAAACAGGCCTGAGAGGGGATTCAGGGAGCAGGGTGTCTGGGGCCCTCT
GCATGGGGGAGCCCTGTACCCATGCCGCACCCTCCATGGCAAGCTGCCTCCCATCTTCTC
CCCAGGTGATGAACATGTATGGAGACCTGGTCATGGACACAGTCCCTGAAAAGGTAGGCC
CAACCAGATAGGTCAGTACCCAGAGGAACTTCTGCAGTTTTAAGCAGCTTTTTAAGCTCC
TTTCATCTCTTTCATTTTACACAGAGAGGGTCTCTGTTTCAGGGAGAGAGGTGGTAGTGG
TAGTGTATTAATTTCAAATCCGTAATCTTGGGCCCTGGATTTATCAGTTGTTTTCCTTTC
TGCCAGTATTTAGTGTTTTTCGCTATGGCCAGCCCCAAGGATTGGGATGGGTTCCTATTG
TAACTATTGTAAAACAAGGTTTAAAAAAAAAAAAAAGAAAAAGGCCACCGGGCATGGTAG
CTCATGCCTGTAATCCCAGCCCTTTGGGAGACCAGGGCGGGTGGATCACCTGAGGTCGGG
AGTTCCAGACCAGCCTGGTCAACATGGTGAAACCCTGGCTCAACTAAAAATATAAAAATA
CAAAAAAGTTAGCTGGGCATAGTGGCGGGTACCTGTAGTCCCAGCTACTCGGGAGGCTGA
GGCGGGAGAATCGCTTGAACCCGGGAGGCGGAGGTTGCAGTGAGTCGAAATCATGCCACT
GCACTCCAGCGTGGGCGACAGAGCAAGGCCCTGCCTCAAAAAAAAAAAAAAAAAAAAAGC
CTGGTTTGTTGACTCATACCTATAATCTCAATGCTCTGGAAGGCCGAGGCAGGCAGACAG
ATTGAGGCCAGGAGTTTGAGACCAACCTGGGCAACATAGTGAGACCCTGTCTCTACCAAA
AAAAAAAGAAAAAACCCAGAATTTGTTTTTACTGTCAGTGGACTGAGGAGGGGAGACTTA
GTGGGAGAGTCTGAGGTCTTTTAATTCCATTGAGCTTTTTTGTGTCATTGGCACAGGTGC
ATTTCTTCAATAGTTTCTTCTATGATAAACTCCGTACCAAGGGTTATGATGGGGTGAAAA
GGTGGACCAAAAACGTGAGTTTTGAATTCACATCTACTTGTGTAATGCCTTGCCTCTAAA
GAATGAGAGTCTTGTTTTCTCTGAGCCCTTTCCCTGACCGTGTTCATTCAGTCTTTCAAA
GATTAAACGTCTCTTGTGTGTGTAGGCACTAAGGATACAGTGTTAAATAAGGAAAACTTG
CCCTTGTGGAGTGAGAATAAAGTTAAATTGCAGCTAGTGATAAGTGCTGTGGGCAGATCA
ACACAGAGTAATGTGAGGCTGGGCGCAGTGGCTCACGCCTGTAATCCCCAGCACTTTGGG
AGGCCAACACGGGCGGATCACCTGAGGTCAGGAGTTCGAGACTAGCCTGGCCAACATTGA
GAAACCCTATCTCTATTAAAAATACAAAAATTAGCCCTGTGTGATGGCAGGTGGCCTGTA
AGCCCAGCTATTCCTGGAGGCTGAGGCAGGAGAATCCCATGAACCTGGGAGGCAGAGGTT
GCAGTGAGCCGAGACCCCGCCATTGCACTCCAGCCTGGGCAACAAGAGCAAAACTCCGTC
TCCAAAAAAAAAAAAAATCACAGTAATGTCATAGCGTGGAAAGTGGGTACTTTAGATTGG
GTGATCTAGGAAGGCCTCTCATAGCTGAGACGTGAATGATGAGCAGCCAGCCATGTGCAG
ACCTGGGAATAGCAAGTACACAAGACCCATAGTGAAAAACCATGGTTGAGGAACAGAAGG
CTTGTGGGGGTGACCTGTGTAGTTGGCGCAGAGTGAGCAAAGGGAGATGGATACAAAATT
CGGTCAGAGAGTAGATCATGTAAGACATGTACGGTAGGCTGAGGAGGGGGGGATTTTATT
GCGTGTATACTGAGAAGCCATTGAGTTTTAAGCAGGCTGAGAAGTGCCTTCTGTTTTAAA
CTCCTGTTTCTAAAAGGGATTGAAAGGGGGGCAANAATNNAANCAGGGCTCCGGTGAGAG
AGTCCAGGTGAGAAACTTGAACTGGAGTGCAAAGGAAGAGGAATCNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAAGTGCTTCTGTTTTAAA
CTCCTGTNCATNGACAGATGAAAGGGGGGGCAGAAATGGAAGCAGGANCAGAGCACATAG
TNCCAGGTGAGAACTTTGAACTGGAGTGCTAAAGGAAGAGAGAGAGAGTAGTTTTATGTA
GGATAAATTTTACGAGTAAAACCAGTAGGACTGACAGGCTCTGTGATACTGAGAGATACA
TATTTGGTCTCCTGACCAGGCTCCTGGCATTCAACTTCTAAAATCCTTGGAATCTCCAGT
GATGTGTGTTTTTGTGTGCTGATGAGTTGATTCATGGCTAGCCCCTCTAGGTGGCTTCAT
GATTAGAGGGTTGGAACTTTCAGCCTCACCCCCACCAACTTCCTGGGAGGGGAATGGGGC
CAAAGGTTAAGGCAATCACTGAGGATCAGTGATTTAATCAGTCATGCCTAGTAGTGAAGC
CTCTAAAAACCCGAAAGGGGCTGGGTGCGGCGGCTCACGCCTGTACTCCCGGCACTTTGG
GAGGCTGAGGCGGATGGATCGCAAGGTCAAGAGATTGAGACCAGCCTGGCCGACCTGGCG
AAACCCTGTCTCTACTAAAAATATGAAAATTAGCTGGGCGTGGTGGCGTGCGCCTGTTGT
CCCCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGGAGGCAGAGGTTGCAGTGAGCC
GAGATTGTGCCACTGCACTCCACCCTGGGTGACAGAGTGAGACTCTGTCTCAAAAAAGAA
AAAAAAAAACCCGAGAGGAGGAGTTTGGAGACATTCTAGATAGCTGAAGGCATGGAGGCT
CCCACAGGATGGCCTCCAGGCCTCTTCCCGGTACCTTTCCCTGTGCATCTTTTCATCTGT
ACTCTTTGTACTACCCTTTGTTAATAAACTGGTAAATGTGTTTCCATGAGTTCTGTGAGC
TGCTCTAGCAAATTAATCAAATTCAAGGAGGGGGTCATGGGAACGCTGATCTAACCAGTT
GGTGAGAAACACAGATAAAACAACCTGGGGCTTAGGACTGGCATCAGAATTGGGGGCAGC
CTTGTGAGACTGAGCCTTAAACCTGTGACACATTATCTCCAGGTAGATAGTGTTGGAATT
GAATTGGGGGATACCCAGCTGTGTCCACCGCAAAATTGCTTGCTTGGTTGTTGGTGGAGA
GAAAGCCCCACAAATACTTCTTGGTGACCACAGGTTACAGAAGTATTTTGTGTTGTGAGA
GTATAGAAGGAAAGAAGATTTGTTTTTTTGCCGGGCGCGGTGGCTCACGCCTGTAATCCC
AGCCCTTTGGGAGGCTGAGGCGGGCGGATCACCAGGTCAGGAGATCAAGACCATCCTGGC
TAACACAGTGAAACCCTGTCTCTACTAAAAATACAAAAAATTAGCCGGGCGAGGTGGCAC
GTGTCTGTAGTCCAAGCTACTTGGGAGGCTGAGGCAGGAGAATGGCGTGAACCCAGGAGG
TGGAGCTTGCAGTGAGGCGAGATCACGCCACTGCACTCCAGCCTGGGCAACAGAGCAAGA
CTCCGTCTCAAAAAAAAAAAACAAAAGATTTGTTTTTCCCTCCGCAGGTTGGATGTGGGA
AATGAAGAAAAAGAAATGGTGGATGATGCCTAGGTTTTTGGCCTATGTAACGGGAAAAGT
GGGAGAGGAACAGGTTTGGGGAGGAAAATGAAGAGTTCTTTTCTCTTCTGGTTTCCCTGC
CCTCCCATTCAAAGGCCAGGAAATTTCTACAGCTAGGCAGGATGATTGGCTCCAGCATTC
CTTAATTTCAGTCCTCAAAATCAAGAGCTTACACCCTCAGGGATCTTCTTGCAGTAGAGG
GAAGGGTGGTGACGTACAGTGAAAAACATGTTGGCCTTCTTCATACTGAGTTTGAGTCCC
ACTTCTGCCATTTCTTTCTTTTATGACCTTGTGCAAGTCACGACTTTCCAAGCTGCAATT
TCCTCATCTGTTAGGTTGAATGTGAGAACTTCCCGGTAGGATTGTTATGAGCATTAACTG
AGTGTTTACTTTATGCTGTGTCTTGTTCTAAGTGTATTATGGATAGTCACTAGTTTAATC
CTCATATCAAATGGCTGAGGTGTAGGTACTACTATTTACACTCTCTGACAGATAAGGAAA
CTGAGGTATAGAAGGTTATTAAGTAGGTTGCCCACTGTCATAAGCCAGTAAATGGAGGAG
CTGTATTTGAATTCTGGCAGGCTCCAGAATCCTGGGCCTGGGTTCTTAGCTGCTAAGTGC
TTCTCCCTTTAAAGTGTGAAAAGCGCCTGCCCATCATGGGTTCTCAAGTGTTCGTTCTGA
TGTCACCTCCATTGTCTGACCTTCCTCCCTTACCCCGAAGAACTGAAACATGCAGATCCT
GAGCTTGCCCACAATCTAGGGCTTGGGTCTTCTGTTCTTTCACTTGGTTCCCTTACCTGT
GTCTCTGTTCCTCTCTAGCACCTTCATGGCAAAAGGCAAGACTTCTGTTTGTTGTACCTG
ACCTGTGGCACTCTCTCTTTAGGTGGACATCTTCAATAAGGAGCTACTGCTAATCCCCAT
CCACCTGGAGGTGCATTGGTCCCTCATCTCTGTTGATGTGAGGCGACGCACCATCACCTA
TTTTGACTCGCAGCGTACCCTAAACCGCCGCTGCCCTAAGGTTTGAGGGGGTAGGAGAGA
GATGGGCAAAATGTGGGGAGGTGCAGTGGCAAGGCATTGCAGGAAGAAGGGTGGGCTTTG
GGTCTTTGAGGGGCGACTTGGGCATGGTGTCTGCCACCACTGTACCCACCATACTGTGTT
CAATTGAGAAACTTAGGGCATCACTTTCTTTTCCCCCATCCACATAGCATATTGCCAAGT
ATCTACAGGCAGAGGCGGTAAAGAAAGACCGACTGGATTTCCACCAGGGCTGGAAAGGTT
ACTTCAAAATGGTGAGTTTCCTGAGGGAGGGGTATAGGGTGTTGGTGGGGACAGTGGTAG
AAGTCAGAAATTGAAGTCCTACCCCTGGGAGTCTCCATGTGAAGGGCCTGCTTTCTTTCT
CTTCTCTAGAATGTGGCCAGGCAGAATAATGACAGTGACTGTGGTGCTTTTGTGTTGCAG
GTAAGCAGATGATGGGGCCACCTCCTCTAGCTCTGAAGTCAGTTGGGTTAAAGGGTCGGG
AGGCTGTTGTGCATCCCCTCATTTGGCTCATAGTCAGTTGTGGAGCAGGAAGTAATCTGT
TTTAGAACACCAAAACACTGGCTTCACTGGTTCTCTTCTGGGCTTCTCCATCCCACATTG
GGACTGGGTCTCTAGTCTTGGGCCTCTGGCCTTCATAGAGCTCCCTGCTAATCTCCAACT
CAGTGTATTTTCTCCATCTAAAACATTCTATCACGTATCAAGTAAGAACACTAGCTTTAG
AGTCAGGCTGTTTTTGAACCCCAGGCTGTGGGACCCTGGCTCCCTTTGGGGATGTTCTCT
GAAGGATGGAGACACATCTCATATGAAATGTGTAGCACAGGTCCTGACACGGGGGGTTTC
TCATGGCCTGCTTTGTTAACACCCAGTACTGCAAGCATCTGGCCCTGTCTCAGCCATTCA
GCTTCACCCAGCAGGACATGCCCAAACTTCGTCGGCAGATCTACAAGGAGCTGTGTCACT
GCAAACTCACTGTGTGAGCCTCGTACCCCAGACCCCAAGCCCATAAATGGGAAGGGAGAC
ATGGGAGTCCCTTCCCAAGAAACTCCAGTTCCTTTCCTCTCTTGCCTCTTCCCACTCACT
TCCCTTTGGTTTTTCATATTTAAATGTTTCAATTTCTGTATTTTTTTTTCTTTGAGAGAA
TACTTGTTGATTTCTGATGTGCAGGGGGTGGCTACAGAAAAGCCCCTTTCTTCCTCTGTT
TGCAGGGGAGTGTGGCCCTGTGGCCTGGGTGGAGCAGTCATCCTCCCCCTTCCCTGTGCA
GGGAGCAGGAAATCAGTGCTGGGGGTGGTGGGCGGACAATAGGATCACTGCCTGCCAGAT
CTTCAAACTTTTTTTTTTATATATATATATATATATAAATGCCACGGTCCTGCTCTGGTC
AATAAAGGATCCTTTGTTGATACGTAAGTGGTGGTCTTCCTTAAGGGGCTTCAAATTAGT
GGATATGCTTAGCTCAGACCTTCCAGCCAGGCTCTTGAGACTAAAGGGTTCAGCTTTCCA
TCCCTGGCTCAGGCACTGCCAACACCTTGTCTTCACCCAAACAAGTCCCCCAGATGGGAG
CAGAGAGCAGGAAGGAGGGAAAGTAGATAAGCCTCAAGAATAAGGGCATCCGAGAGGGAA
GCTGGGGAACTGGACACAAGGGACTGGGGAGGGGACCAACCAGGATTCATGATAGTACCC
CAAAGCCCTTTACAGTTTTCTTCCATCCCTCCACCATCCAGCCAGGGGAATCCTCCCATC
CCTACGATATCGCTGTTGATTCCTTCATCCCTGGCACACGTCCAGGCAGTGTCGAATCCA
TCTCTGCTACAGGGGAAAACAAGTAACAAATAATTTGAGTCCAGTGGAAACCTGGAGCAG
AAGTAAAGGGAAGTGATAACCCCCAGAGCCCGGAAGCCTCTGGAGGCTGAGACCTCGCCC
CCCTTGCGTGATAGGGCCTACGGAGCCACATGACCAAGGCACTGTCGCCTCCGCACGTGT
GAGAGTGCAGGGCCCCAAGATGGCTGCCAGGCCTCGAGGCCTGACTCCTCTATGTCACTT
CCGTACCGGCGAGAAAGGCGGGCCCTCCAGCCAATGAGGCTGCGGGGCGGGCCTTCACCT
TGATAGGCACTCGAGTTATCCAATGGTGCCTGCGGGCCGGAGCGACTAGGAACTAACGTC
GTGCCGAGTTGCTGAGCGCCGGCAGGCGGGGCCGGGGCGGCCAAACCAATGCGATGGCCG
GGGCGGAGTCGGGCGCTCTATAAGTTGTCGATAGGCGGGCACTCCGCCCTAGTTTCTAAG
GATCATGTCTGCGAGCCAGGATTCCCGGTAAGAAAGGCATTTGCAAGAGATTGTGGCTGC
TTATTTTGCCGCCCCCTTCCGACGGGCCCGCCGGGGGTAGCTGAGAGGCCCACCAGGGTT
GCGGGAGAAACCGAGCCGGGTGGGGGGAGGGTCCGACCTGGAGGGGCGAGGGGGAAGATC
CACGGCCGACGCGGCCACCAGGTCGAGGCGGAGGGCAGGGACAGCCCGGCTAGGGTCAGG
CGTGCGAGGTCTGTTACGAGGCCTCGACCCGAGGCGGTGCCATGCGCGAAGCCCCGGCGC
TGAGTGGCGAGACGGGGTCGCGACCTGGCGTGGGAAAGAAAGGTGGAGGCGGCCGCCACT
ATGTGTGGCCCAGAGCCGGCAGGTCCGGTTGCCTCCCTGTGCCGGGGGAGGGACGGCGCG
CGGGGTTCCGGAGCATTCTGACGGTACCACTCGCGAGAGGCGGGGGTGCTTGGTCCTTAG
ATCCAGTCACTTCGTCGCGGCTAAAGCACGGGTCGGGGAGAAGAAACCGGCCGTTCAGTG
TGCTGGTTTTCTTGACGGCCAGGACTGAGCCTAACCCCGAGGAGCGGCCGCGTGAGGCAC
CAGGAGCCCACCCGGCGCCGGGCGGGCGGGTCCATTTTGCCGCACAAGCCGGGCTATTGG
CAAACTGCGGATGGGCAGGTCCACCTTCCTTCGGGGGTGAGCGGCCTGAGGTATGGGAGG
GCGACGCTACTTCGCGACGGGGGCGGGCGGGATGTGGATTGTTCCATGGAGGGTTGGGAG
ACGCCGCCGGGTGGTCGAGGGAGCGAGCACATGGTGGCCTGAGGCGTTCCCCTCCCCCAG
TCTGCTTCGCTTCTAAGTGTTGTGCAATCTCCCCCTTTGCTAGCTCGGCTTGGGCTCATT
GTGCGCGAGGCCGCCACCGCCCGCGGCCTCCCACATCCGGGCAACGCGAGGGGGGGCTTC
GGCTGGAGGGAGTGGGGGAGGGCGCGGGCGGGATGACGTGGGGGGAAGGGGATGTCCTAC
CCTCCGATCTGGGAGGTGAAGGGCGGGACTTCCAGCGCGCTGGTGCTGCGGTGGGAGGTG
CACGCGCTTGGGCTTTAAGCGGCTGGGTCGGGCCCACGTGGACCCGGCGGCAAGCACCAC
CTCTGGGCACCGTGAGCGCGGCGGCACGCCTGCCAGCCTGTCTTCAGAAAGGGTCACCCC
CTTATGTCGGGGGTGGCCTGGCCTGAGCCGCTGCCTGCATGGGGCAAATGCCTCAGTTTT
ATAGAAACTCCTCCTTTGGGTACTTTTTGGGAGCTGGTGGGAGTTGGATCTGGGAGAGCA
GGTTGATGGCATCATGCAGGCCACTCCTGACAGAGCCCGGCTGTCAGGATTTCTGAGTGC
TTCGGTCGGGCAGGGGACAAAACTTGTGCTTTAAACCAACAGATCCAGAGACAATGGCCC
CGATGGGATGGAGCCCGAAGGCGTCATCGAGGTGAGACTGGAGAAATGGAATTCTGTCCT
CCCCCATTACAACTTTCAGCCTCACAGTTGTATAGAGTTAGAGTGGCCTCTTGATTGATT
TCCCAGACCATCTAGAAGCAGCTGGTTTCCCTAAAGGGAGGAGGGGTTGTAAGCTCTGAG
GCTTTTGTTAGTGGGCACCAGATTCTGTTTGCTCTGAGACTACAGCTCAGCTCCACCTTT
TCCATGACTCAAGCTTTAATTTCTTTGCATCCCCTAGAGTAACTGGAATGAGATTGTTGA
CAGCTTTGATGACATGAACCTCTCGGAGTCCCTTCTCCGTGGTATCTACGCCTATGGTTT
TGAGAAGCCCTCTGCCATCCAGCAGCGAGCCATTCTACCTTGTATCAAGGGTGAGACCTC
TCAGTCCCAGAAGACATTGTGGACTGTCCCTGACCTGGGTAGAGTGGCATCTGGTTGGTG
ATGCCCATCTCATATCAGCCAGGGACAAAGCAACTCCTTGTTCATCCCAGCTTGGCTTTT
GATCCGTGCCCATGCCTGGTTCATGCCTTGGACACATAGTTTTCCTTTAAAGAGGTGGTA
TTGTAGCCAGCTTATACTTGCATCTACAGCCATGTTTCTAGTCCAGCTTGGTGTGCAATA
CTAGATGAGTTAATAACTGGTCCTTGTTTCTGATCTGGTTCCCATTGTGTAACTGTTGAT
TGGGAAGGTAGTTTGTGAGCCATGAAATGCTTGGTTCATTGGTTGCTTATTGACCTCATT
AACCTAGGACTTGAATATCCCAAAGGGTATGCTCTTTACCACATTCAACTCCTAATTTAT
TTGTTTAGGTTATGATGTGATTGCTCAAGCCCAATCTGGGACTGGGAAAACGGCCACATT
TGCCATATCGATTCTGCAGCAGATTGAATTAGATCTAAAAGCCACCCAGGCCTTGGTCCT
AGCACCCACTCGAGAATTGGCTCAGCAGGTAAGAGTGGCTTCTATTCCCTCCTTCAGGGC
TGATTTAGGGATGATGAGTATAATCCAAGGACCAGAGAAGTCTTCTCTGATCACCACCTT
GGGAGGAAGACATGGGTGCCCTAACACTCTCGAGACCTGCTGGGTTAATTAAAAGCTATT
TCTTACCCAAACGTAACCATTGCTTCCTCCACCCATTTCCTGAGTCAAATGGGAAGGCTG
TTGGGTGAAGCCTGGCTGGCTGGGCAAGTTTGACTGTGTTCTGAATAAGCACCTTCACTA
TGGGCTAAGAGATACCTTGGTGGTGGGGGTGATCTTACAGTAGTCAGAGCAGATGGACAG
TCCTTTTCACCCTTGCTAATGGCCAGAGCTGTTTCATGCCTGGGGCACACACAATTCTAA
TGCTGGACTTTTTCCTGGGTCATGCTGCAACACTGATGTCAGAGCATGTTTTTAAATGTT
CTGTGGCGGGGGCAGTGATTATTCTGGGTGTGGATAATGTAAGAAGTTACAGCAGAGCTC
CATTCTAAGGCACTTGGCTCTCAGTTTTCTCAGAGTGAACATGCCTCGTAGTTTGGGTCC
TATGGCAGGAGTGCAATAGGACATGGATATGCATCACCTGTTCTACAAAACTGGTTGCTG
GCTGGGCGCAGTGGCTCACTCCTATAATCCCGACACTTTGGGAGGCCAAGGCAGGCAGAT
CACTTGAGATCAGGAGTTGGAGACCGGCCTGGCCAACATAGTGAAACCCCGCCTCTACTA
AAAATACAAAAATTAGCCAGGCATGGTGGCGTGTGCCTTTTATCCCAGCTACTCGGGAAG
CTCAGGCAGGAGAATTTAACCCAGGAGGTGGAGGTTGCAGTGAGCTGAGATTGTGCCATT
GCACTCCAGCCTGGGCAACGAGCAAAGCTCTGTCTCAAAAAAAGAAAAAAAAATGGTTGC
TGCGTGATGAGGCAGTTGGTCAAATTAGTTTTCAAAAGGTTAAGGGTTCTAAATATCTAG
AGTAAGAAACTGAATTAATTATCTGAGCGGCCTCATTGTGAATCACTGTACACTCAGGAA
CCAGACTGAGTTGAAATCCTGTCTTTGCCACCTATTGACAGCACGATCTTAAGTGGATTT
TAGCCTCTGCCTGTTTCTCAGCTGAATGTGAGTTTAATAATAGTGCATGCCCCAAAGTTG
TTGGTTAGGAATCAATACATGAAAAACATTTAAGAATGGTGCCGGGCACAGTGGTAGCTG
ACATATGAGCACCTGCCTCTCTCTGCTCAGATACAGAAGGTGGTCATGGCATTAGGAGAC
TACATGGGCGCCTCCTGTCACGCCTGTATCGGGGGCACCAACGTGCGTGCTGAGGTGCAG
AAACTGCAGATGGAAGCTCCCCACATCATCGTGGGTACCCCTGGCCGTGTGTTTGATATG
CTTAACCGGAGATACCTGTGTGAGTAATTCAGTTCTCCAATCCCCTGGGTCACTTTGCTC
TTGTGCACGCTTTCCAGTCTTTCAGCGTAAGCCAGAGTCATTCCCAAGGATGCTGGTTTC
TCTCTGGGGGAAGAGCTGCTCTGTGATGGAGCCCATGCGTGTCATCTGAGCCTCTGGCTT
CCCTGCCAGTGCAGCCCTGGCAGTGTCCTACTTCCCAGGGCTGTTGTCTGCCTGGCGGGA
AGGTCCTGGGCAAAGGATCAGTCTTTGTACTCTGAGAGCAGACTACTTGGCCCCTCTGTG
TTTTTTATCAGCGAAGTTGGATATATCTCTCCCACATTTCCCTAATTATATGCTATATAT
TGGCTTTTTTTTTTCTCTAGCCCCCAAGTACATCAAGATGTTTGTACTGGATGAAGCTGA
CGAAATGTTAAGCCGTGGATTCAAGGACCAGATCTATGACATATTCCAAAAGCTCAACAG
CAACACCCAGGTGAGGGCAGTCTTGCTTGAATAGCTAATGATTCTTGAAAAATAGTAAGT
GCCAGGGGAACCAAATACTGGATTCTTGTCTTGAGCCTTTTTATGCATCTGCTTCAGTTT
TAGGTGTGGCTAGGGAAGGGAGCAGGCCTCAGGAAGGAACCAGCACTCTAAGACTGGCCT
TTTTTTCCACTAGGTAGTTTTGCTGTCAGCCACAATGCCTTCTGATGTGCTTGAGGTGAC
CAAGAAGTTCATGAGGGACCCCATTCGGATTCTTGTCAAGAAGGAAGAGTTGACCCTGGA
GGGTATCCGCCAGTTCTACATCAACGTGGAACGAGAGGTGGGGCCCAGTGCAGGAGGCGG
GCCTGGTAGTGAGTTGTTGGGTATAGCCCCTGACTGATTTTTGTCCCCCAACCTCCAGGA
GTGGAAGCTGGACACACTATGTGACTTGTATGAAACCCTGACCATCACCCAGGCAGTCAT
CTTCATCAACACCCGGAGGAAGGTGGACTGGCTCACCGAGAAGATGCATGCTCGAGATTT
CACTGTATCCGCCATGGTGTGTTTGCCCGCTGCCAGCCTGTTGTGGGTCTGCCCGTCAGA
AGTGTCCTACTTGAAGCCAGGGTTCCTGGAACCCATGTGCCTACCTGGTCTGCTGCATAT
TTGTTTTCTCTTCCAGCATGGAGATATGGACCAAAAGGAACGAGACGTGATCATGAGGGA
GTTTCGTTCTGGCTCTAGCAGAGTTTTGATTACCACTGACCTGCTGGTGAGTTGAGGGAA
CTGATAGGAAAGGCAGAAGGGAGGATCCAAGGTGATTCCCTCTCCAAGGGGACATCAGTG
CCTCTCAGGAAAGTAGCAGCTTGGAATAGAATCTGGCATGCCTAAGGCCTTTGGGGAACT
GGGATGCTTATTTCCTCTGCCTTCCTTGGCTGCCCACATGGATGCCTAAGTGTCTTCCCT
CCGGGATAGAGTGTCCTCCGTGCACATGCTGAAGAGTTGTCTTTCTTGACGTAGGCCAGA
GGCATTGATGTGCAGCAGGTTTCTTTAGTCATCAACTATGACCTTCCCACCAACAGGGAA
AACTATATCCACAGGTAAGCGTAGATCTGGAACACTCCCCTACCCCTTCACACCTGGCCC
TCCCTGGGCTTAAAGCTCCTGATATTCCTCATCCCCTTCCTTGTTTTCCAGAATCGGTCG
AGGTGGACGGTTCGGCCGTAAAGGTGTGGCTATTAACATGGTGACAGAAGAAGACAAGAG
GACTCTTCGAGACATTGAGACCTTTTACAACACCTCCATTGAGGAAATGCCCCTCAATGT
TGCTGACCTCATCTGAGGGGCTGTCCTGCCACCCAGCCCCAGCCAGGGCTCAATCTCTGG
GGGCTGAGGAGCAGCAGGAGGGGGGAGGGAAGGGAGCCAAGGGATGGACATCTTGTCATT
TTTTTCTTTGAATAAATGTCACTTTTTGAGGCAAAAGAAGGAACCGTGAACATTTTAGAC
ACCCTTTTCTTTGGGGTAGGCTCTTGCCCCAGGCGCCGGCTCTTCTCCCCCCCCCAAAAA
AAAAAAAAAACACTAATCCATTTCCCTAACCTAGTAACCTCCAGATCCCAGAGGCTCTCC
TCACCTCAGCTGAGCTCCTTTGAAAGTGATTCAAGGGACTATGTCACTCAGCCTCATTTG
CTGGACCAAATCTGGAGGGAGAACCCCTAAAACCCCTAAGTGAGGTTGCCCAGGGGGTTG
TCCCCAGGTGGGGGGAAGCAGGGGAGAGAAAATGGTAGCCATTTTTACATTGTTTTGTAT
AGTATTTATTGATTCAGGAAACAAACACAAAATTCTGAATAAAATGACTTGGAAACTGCC
TGTTTGGGCTTCTCATTTCTTACTTCCCCTTCCCTCTCCCACCTGCTACTGGATGCATCT
CTGCTCCCCCCTTCCCCAGCAGATGGTTACCTTTGGGCTGTTGCTTTCTTGTCACCATCT
GAGTTCCCAGACCCTGGAAAGCCATGTTCTCGGCTCTGAGAACGACAATGCTGACTGGAG
TGCTGCCCCTCTGTAAAGGGCTGGGTGTGGATGGTCACAAGCCCCTCACGTGCCGCAGCC
AAGAGGAAGTAGTACAGGGGTCAGCCCAGAGGTCCAGGGGAAAGGGGAGTGGAAACTGAT
TTCCCCACCGAGGGAGGGGCCTGTACCTCAGCTGTTCCCATAGCCACTTGCCACAACTGC
CAAGCAAGTTTCGCTGAGTTTGACACATGGATCCCTGTGGATCAACTGCCCTAGGACTCC
CTGTTTGCACCCATGTGACACTGTTGACTTTGCCCTGATGAAGCAGGGCCAACAGTCCCC
TAACTTAATTACAAAAACTAATGACTAAGAGAGAGGTGGCTAGAGCTGAGGCCCCTGAGT
CAGGCTGTGGGTGGGATCATCTCCAGTACAGGAAGTGAGACTTTCATTTCCTCCTTTCCA
AGAGAGGGCTGAGGGAGCAGGGTTGAGCAACTGGTGCAGACAGCCTAGCTGGACTTTGGG
TGAGGCGGTTCAGCCATGAGGCTGGCTGTGCTTTTCTCGGGGGCCCTGCTGGGGCTACTG
GCAGGTAAGGAGGAAGGAGGCTGAGGGGAGGGGGGCCCCTGGGAGGGAGCCTGACCTGGG
TTGCTAACCATCTCCTCTCTGCCAAAAGCCCAGGGGACAGGGAATGACTGTCCTCACAAA
AAATCAGCTACTTTGCTGCCATCCTTCACGGTGACACCCACGGTTACAGAGAGCACTGGG
ACCACCAGCCACAGGACGACCAAGAGCCACAAAACCACCACTCACAGGACAACCACCACA
GGCACCGCCAGCCACGGACCCACGACTGCCACTCACAACC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1015, 9034..9090, 9337..9469, 9908..10047, 11310..11478, 11840..11949, 12133..12276, 12358..12495, 12616..12705, 12954..13033, 13131..13799
1001..1015, 9034..9090, 9337..9469, 9908..10047, 11310..11478, 11840..11949, 12133..12276, 12358..12495, 12616..12705, 12954..13033, 13131..13272
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved