Pan_troglodytes Locus IF4A1_PANTR
snOPY snoRNA Orthological Gene Database
Pan_troglodytes IF4A1_PANTR
Pan_troglodytes
IF4A1_PANTR
17
SNORA48
3018..3152
7789
TGATTTCTGATGTGCAGGGGGTGGCTACAGAAAAGCCCCTTTCTTCCTCTGTTTGCAGG
GGAGTGTGGCCCTGTGGCCTGGGTGGAGCAGTCATCCTCCCCCTTCCCTGTGCAGGGAGC
AGGAAATCAGTGCTGGGGGTGGTGGGCGGACAATAGGATCACTGCCTGCCAGATCTTCAA
ACTTTTTTTTTTATATATATATATATATATAAATGCCACGGTCCTGCTCTGGTCAATAAA
GGATCCTTTGTTGATACGTAAGTGGTGGTCTTCCTTAAGGGGCTTCAAATTAGTGGATAT
GCTTAGCTCAGACCTTCCAGCCAGGCTCTTGAGACTAAAGGGTTCAGCTTTCCATCCCTG
GCTCAGGCACTGCCAACACCTTGTCTTCACCCAAACAAGTCCCCCAGATGGGAGCAGAGA
GCAGGAAGGAGGGAAAGTAGATAAGCCTCAAGAATAAGGGCATCCGAGAGGGAAGCTGGG
GAACTGGACACAAGGGACTGGGGAGGGGACCAACCAGGATTCATGATAGTACCCCAAAGC
CCTTTACAGTTTTCTTCCATCCCTCCACCATCCAGCCAGGGGAATCCTCCCATCCCTACG
ATATCGCTGTTGATTCCTTCATCCCTGGCACACGTCCAGGCAGTGTCGAATCCATCTCTG
CTACAGGGGAAAACAAGTAACAAATAATTTGAGTCCAGTGGAAACCTGGAGCAGAAGTAA
AGGGAAGTGATAACCCCCAGAGCCCGGAAGCCTCTGGAGGCTGAGACCTCGCCCCCCTTG
CGTGATAGGGCCTACGGAGCCACATGACCAAGGCACTGTCGCCTCCGCACGTGTGAGAGT
GCAGGGCCCCAAGATGGCTGCCAGGCCTCGAGGCCTGACTCCTCTATGTCACTTCCGTAC
CGGCGAGAAAGGCGGGCCCTCCAGCCAATGAGGCTGCGGGGCGGGCCTTCACCTTGATAG
GCACTCGAGTTATCCAATGGTGCCTGCGGGCCGGAGCGACTAGGAACTAACGTCGTGCCG
AGTTGCTGAGCGCCGGCAGGCGGGGCCGGGGCGGCCAAACCAATGCGATGGCCGGGGCGG
AGTCGGGCGCTCTATAAGTTGTCGATAGGCGGGCACTCCGCCCTAGTTTCTAAGGATCAT
GTCTGCGAGCCAGGATTCCCGGTAAGAAAGGCATTTGCAAGAGATTGTGGCTGCTTATTT
TGCCGCCCCCTTCCGACGGGCCCGCCGGGGGTAGCTGAGAGGCCCACCAGGGTTGCGGGA
GAAACCGAGCCGGGTGGGGGGAGGGTCCGACCTGGAGGGGCGAGGGGGAAGATCCACGGC
CGACGCGGCCACCAGGTCGAGGCGGAGGGCAGGGACAGCCCGGCTAGGGTCAGGCGTGCG
AGGTCTGTTACGAGGCCTCGACCCGAGGCGGTGCCATGCGCGAAGCCCCGGCGCTGAGTG
GCGAGACGGGGTCGCGACCTGGCGTGGGAAAGAAAGGTGGAGGCGGCCGCCACTATGTGT
GGCCCAGAGCCGGCAGGTCCGGTTGCCTCCCTGTGCCGGGGGAGGGACGGCGCGCGGGGT
TCCGGAGCATTCTGACGGTACCACTCGCGAGAGGCGGGGGTGCTTGGTCCTTAGATCCAG
TCACTTCGTCGCGGCTAAAGCACGGGTCGGGGAGAAGAAACCGGCCGTTCAGTGTGCTGG
TTTTCTTGACGGCCAGGACTGAGCCTAACCCCGAGGAGCGGCCGCGTGAGGCACCAGGAG
CCCACCCGGCGCCGGGCGGGCGGGTCCATTTTGCCGCACAAGCCGGGCTATTGGCAAACT
GCGGATGGGCAGGTCCACCTTCCTTCGGGGGTGAGCGGCCTGAGGTATGGGAGGGCGACG
CTACTTCGCGACGGGGGCGGGCGGGATGTGGATTGTTCCATGGAGGGTTGGGAGACGCCG
CCGGGTGGTCGAGGGAGCGAGCACATGGTGGCCTGAGGCGTTCCCCTCCCCCAGTCTGCT
TCGCTTCTAAGTGTTGTGCAATCTCCCCCTTTGCTAGCTCGGCTTGGGCTCATTGTGCGC
GAGGCCGCCACCGCCCGCGGCCTCCCACATCCGGGCAACGCGAGGGGGGGCTTCGGCTGG
AGGGAGTGGGGGAGGGCGCGGGCGGGATGACGTGGGGGGAAGGGGATGTCCTACCCTCCG
ATCTGGGAGGTGAAGGGCGGGACTTCCAGCGCGCTGGTGCTGCGGTGGGAGGTGCACGCG
CTTGGGCTTTAAGCGGCTGGGTCGGGCCCACGTGGACCCGGCGGCAAGCACCACCTCTGG
GCACCGTGAGCGCGGCGGCACGCCTGCCAGCCTGTCTTCAGAAAGGGTCACCCCCTTATG
TCGGGGGTGGCCTGGCCTGAGCCGCTGCCTGCATGGGGCAAATGCCTCAGTTTTATAGAA
ACTCCTCCTTTGGGTACTTTTTGGGAGCTGGTGGGAGTTGGATCTGGGAGAGCAGGTTGA
TGGCATCATGCAGGCCACTCCTGACAGAGCCCGGCTGTCAGGATTTCTGAGTGCTTCGGT
CGGGCAGGGGACAAAACTTGTGCTTTAAACCAACAGATCCAGAGACAATGGCCCCGATGG
GATGGAGCCCGAAGGCGTCATCGAGGTGAGACTGGAGAAATGGAATTCTGTCCTCCCCCA
TTACAACTTTCAGCCTCACAGTTGTATAGAGTTAGAGTGGCCTCTTGATTGATTTCCCAG
ACCATCTAGAAGCAGCTGGTTTCCCTAAAGGGAGGAGGGGTTGTAAGCTCTGAGGCTTTT
GTTAGTGGGCACCAGATTCTGTTTGCTCTGAGACTACAGCTCAGCTCCACCTTTTCCATG
ACTCAAGCTTTAATTTCTTTGCATCCCCTAGAGTAACTGGAATGAGATTGTTGACAGCTT
TGATGACATGAACCTCTCGGAGTCCCTTCTCCGTGGTATCTACGCCTATGGTTTTGAGAA
GCCCTCTGCCATCCAGCAGCGAGCCATTCTACCTTGTATCAAGGGTGAGACCTCTCAGTC
CCAGAAGACATTGTGGACTGTCCCTGACCTGGGTAGAGTGGCATCTGGTTGGTGATGCCC
ATCTCATATCAGCCAGGGACAAAGCAACTCCTTGTTCATCCCAGCTTGGCTTTTGATCCG
TGCCCATGCCTGGTTCATGCCTTGGACACATAGTTTTCCTTTAAAGAGGTGGTATTGTAG
CCAGCTTATACTTGCATCTACAGCCATGTTTCTAGTCCAGCTTGGTGTGCAATACTAGAT
GAGTTAATAACTGGTCCTTGTTTCTGATCTGGTTCCCATTGTGTAACTGTTGATTGGGAA
GGTAGTTTGTGAGCCATGAAATGCTTGGTTCATTGGTTGCTTATTGACCTCATTAACCTA
GGACTTGAATATCCCAAAGGGTATGCTCTTTACCACATTCAACTCCTAATTTATTTGTTT
AGGTTATGATGTGATTGCTCAAGCCCAATCTGGGACTGGGAAAACGGCCACATTTGCCAT
ATCGATTCTGCAGCAGATTGAATTAGATCTAAAAGCCACCCAGGCCTTGGTCCTAGCACC
CACTCGAGAATTGGCTCAGCAGGTAAGAGTGGCTTCTATTCCCTCCTTCAGGGCTGATTT
AGGGATGATGAGTATAATCCAAGGACCAGAGAAGTCTTCTCTGATCACCACCTTGGGAGG
AAGACATGGGTGCCCTAACACTCTCGAGACCTGCTGGGTTAATTAAAAGCTATTTCTTAC
CCAAACGTAACCATTGCTTCCTCCACCCATTTCCTGAGTCAAATGGGAAGGCTGTTGGGT
GAAGCCTGGCTGGCTGGGCAAGTTTGACTGTGTTCTGAATAAGCACCTTCACTATGGGCT
AAGAGATACCTTGGTGGTGGGGGTGATCTTACAGTAGTCAGAGCAGATGGACAGTCCTTT
TCACCCTTGCTAATGGCCAGAGCTGTTTCATGCCTGGGGCACACACAATTCTAATGCTGG
ACTTTTTCCTGGGTCATGCTGCAACACTGATGTCAGAGCATGTTTTTAAATGTTCTGTGG
CGGGGGCAGTGATTATTCTGGGTGTGGATAATGTAAGAAGTTACAGCAGAGCTCCATTCT
AAGGCACTTGGCTCTCAGTTTTCTCAGAGTGAACATGCCTCGTAGTTTGGGTCCTATGGC
AGGAGTGCAATAGGACATGGATATGCATCACCTGTTCTACAAAACTGGTTGCTGGCTGGG
CGCAGTGGCTCACTCCTATAATCCCGACACTTTGGGAGGCCAAGGCAGGCAGATCACTTG
AGATCAGGAGTTGGAGACCGGCCTGGCCAACATAGTGAAACCCCGCCTCTACTAAAAATA
CAAAAATTAGCCAGGCATGGTGGCGTGTGCCTTTTATCCCAGCTACTCGGGAAGCTCAGG
CAGGAGAATTTAACCCAGGAGGTGGAGGTTGCAGTGAGCTGAGATTGTGCCATTGCACTC
CAGCCTGGGCAACGAGCAAAGCTCTGTCTCAAAAAAAGAAAAAAAAATGGTTGCTGCGTG
ATGAGGCAGTTGGTCAAATTAGTTTTCAAAAGGTTAAGGGTTCTAAATATCTAGAGTAAG
AAACTGAATTAATTATCTGAGCGGCCTCATTGTGAATCACTGTACACTCAGGAACCAGAC
TGAGTTGAAATCCTGTCTTTGCCACCTATTGACAGCACGATCTTAAGTGGATTTTAGCCT
CTGCCTGTTTCTCAGCTGAATGTGAGTTTAATAATAGTGCATGCCCCAAAGTTGTTGGTT
AGGAATCAATACATGAAAAACATTTAAGAATGGTGCCGGGCACAGTGGTAGCTGACATAT
GAGCACCTGCCTCTCTCTGCTCAGATACAGAAGGTGGTCATGGCATTAGGAGACTACATG
GGCGCCTCCTGTCACGCCTGTATCGGGGGCACCAACGTGCGTGCTGAGGTGCAGAAACTG
CAGATGGAAGCTCCCCACATCATCGTGGGTACCCCTGGCCGTGTGTTTGATATGCTTAAC
CGGAGATACCTGTGTGAGTAATTCAGTTCTCCAATCCCCTGGGTCACTTTGCTCTTGTGC
ACGCTTTCCAGTCTTTCAGCGTAAGCCAGAGTCATTCCCAAGGATGCTGGTTTCTCTCTG
GGGGAAGAGCTGCTCTGTGATGGAGCCCATGCGTGTCATCTGAGCCTCTGGCTTCCCTGC
CAGTGCAGCCCTGGCAGTGTCCTACTTCCCAGGGCTGTTGTCTGCCTGGCGGGAAGGTCC
TGGGCAAAGGATCAGTCTTTGTACTCTGAGAGCAGACTACTTGGCCCCTCTGTGTTTTTT
ATCAGCGAAGTTGGATATATCTCTCCCACATTTCCCTAATTATATGCTATATATTGGCTT
TTTTTTTTCTCTAGCCCCCAAGTACATCAAGATGTTTGTACTGGATGAAGCTGACGAAAT
GTTAAGCCGTGGATTCAAGGACCAGATCTATGACATATTCCAAAAGCTCAACAGCAACAC
CCAGGTGAGGGCAGTCTTGCTTGAATAGCTAATGATTCTTGAAAAATAGTAAGTGCCAGG
GGAACCAAATACTGGATTCTTGTCTTGAGCCTTTTTATGCATCTGCTTCAGTTTTAGGTG
TGGCTAGGGAAGGGAGCAGGCCTCAGGAAGGAACCAGCACTCTAAGACTGGCCTTTTTTT
CCACTAGGTAGTTTTGCTGTCAGCCACAATGCCTTCTGATGTGCTTGAGGTGACCAAGAA
GTTCATGAGGGACCCCATTCGGATTCTTGTCAAGAAGGAAGAGTTGACCCTGGAGGGTAT
CCGCCAGTTCTACATCAACGTGGAACGAGAGGTGGGGCCCAGTGCAGGAGGCGGGCCTGG
TAGTGAGTTGTTGGGTATAGCCCCTGACTGATTTTTGTCCCCCAACCTCCAGGAGTGGAA
GCTGGACACACTATGTGACTTGTATGAAACCCTGACCATCACCCAGGCAGTCATCTTCAT
CAACACCCGGAGGAAGGTGGACTGGCTCACCGAGAAGATGCATGCTCGAGATTTCACTGT
ATCCGCCATGGTGTGTTTGCCCGCTGCCAGCCTGTTGTGGGTCTGCCCGTCAGAAGTGTC
CTACTTGAAGCCAGGGTTCCTGGAACCCATGTGCCTACCTGGTCTGCTGCATATTTGTTT
TCTCTTCCAGCATGGAGATATGGACCAAAAGGAACGAGACGTGATCATGAGGGAGTTTCG
TTCTGGCTCTAGCAGAGTTTTGATTACCACTGACCTGCTGGTGAGTTGAGGGAACTGATA
GGAAAGGCAGAAGGGAGGATCCAAGGTGATTCCCTCTCCAAGGGGACATCAGTGCCTCTC
AGGAAAGTAGCAGCTTGGAATAGAATCTGGCATGCCTAAGGCCTTTGGGGAACTGGGATG
CTTATTTCCTCTGCCTTCCTTGGCTGCCCACATGGATGCCTAAGTGTCTTCCCTCCGGGA
TAGAGTGTCCTCCGTGCACATGCTGAAGAGTTGTCTTTCTTGACGTAGGCCAGAGGCATT
GATGTGCAGCAGGTTTCTTTAGTCATCAACTATGACCTTCCCACCAACAGGGAAAACTAT
ATCCACAGGTAAGCGTAGATCTGGAACACTCCCCTACCCCTTCACACCTGGCCCTCCCTG
GGCTTAAAGCTCCTGATATTCCTCATCCCCTTCCTTGTTTTCCAGAATCGGTCGAGGTGG
ACGGTTCGGCCGTAAAGGTGTGGCTATTAACATGGTGACAGAAGAAGACAAGAGGACTCT
TCGAGACATTGAGACCTTTTACAACACCTCCATTGAGGAAATGCCCCTCAATGTTGCTGA
CCTCATCTGAGGGGCTGTCCTGCCACCCAGCCCCAGCCAGGGCTCAATCTCTGGGGGCTG
AGGAGCAGCAGGAGGGGGGAGGGAAGGGAGCCAAGGGATGGACATCTTGTCATTTTTTTC
TTTGAATAAATGTCACTTTTTGAGGCAAAAGAAGGAACCGTGAACATTTTAGACACCCTT
TTCTTTGGGGTAGGCTCTTGCCCCAGGCGCCGGCTCTTCTCCCCCCCCCAAAAAAAAAAA
AAAACACTAATCCATTTCCCTAACCTAGTAACCTCCAGATCCCAGAGGCTCTCCTCACCT
CAGCTGAGCTCCTTTGAAAGTGATTCAAGGGACTATGTCACTCAGCCTCATTTGCTGGAC
CAAATCTGGAGGGAGAACCCCTAAAACCCCTAAGTGAGGTTGCCCAGGGGGTTGTCCCCA
GGTGGGGGGAAGCAGGGGAGAGAAAATGGTAGCCATTTTTACATTGTTTTGTATAGTATT
TATTGATTCAGGAAACAAACACAAAATTCTGAATAAAATGACTTGGAAACTGCCTGTTTG
GGCTTCTCATTTCTTACTTCCCCTTCCCTCTCCCACCTGCTACTGGATGCATCTCTGCTC
CCCCCTTCCCCAGCAGATGGTTACCTTTGGGCTGTTGCTTTCTTGTCACCATCTGAGTTC
CCAGACCCTGGAAAGCCATGTTCTCGGCTCTGAGAACGACAATGCTGACTGGAGTGCTGC
CCCTCTGTAAAGGGCTGGGTGTGGATGGTCACAAGCCCCTCACGTGCCGCAGCCAAGAGG
AAGTAGTACAGGGGTCAGCCCAGAGGTCCAGGGGAAAGGGGAGTGGAAACTGATTTCCCC
ACCGAGGGAGGGGCCTGTACCTCAGCTGTTCCCATAGCCACTTGCCACAACTGCCAAGCA
AGTTTCGCTGAGTTTGACACATGGATCCCTGTGGATCAACTGCCCTAGGACTCCCTGTTT
GCACCCATGTGACACTGTTGACTTTGCCCTGATGAAGCAGGGCCAACAGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1160, 2556..2604, 2851..2983, 3422..3561, 4824..4992, 5354..5463, 5647..5790, 5872..6219, 6468..6547, 6645..7313
1138..1160, 2556..2604, 2851..2983, 3422..3561, 4824..4992, 5354..5463, 5647..5790, 5872..6219, 6468..6547, 6645..6789
NC_006484
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved