Pan_troglodytes Locus XR_020152.1
snOPY snoRNA Orthological Gene Database
Pan_troglodytes XR_020152.1
Pan_troglodytes
XR_020152.1
9
SNORD24, SNORD36, SNORD36, SNORD36
2156..2230, 2855..2927, 3216..3288, 3607..3674
5191
GAGAATCGCTTGAACCCGGGAAGCACAGATCGCAGTGAGCCGAGATCGCACCACTGCAC
TCCAGCCTGGGCGACAGGGGGAGACTACGTCTCCAAAAGAAAAAAAAAAGGGGGGTAATT
CCACTCCCTCGCTTAACATCCCTCATGGTTCCCCGGTGCGCCGGAACAAGGGGCTCAAGT
TCCGCGCCGCGCCTCTCGGCCTCTGCCCTGCAGCCGCACTGGACGGCCTCGGCGCTGGAG
TTGCCTGGCCCTCGGGCCGGGCCTTTGCGCGCGGTGCTCAGGGAGGGCCCGGGGCCCCCT
AGGTTCGGAGTCTGGCGCACGACCGAGCGGACTCCTGGACGCACTCGCATTGTTTGTGCC
CATTTTGGCGGGGTGTGGGAAATAAGTCACACGCAGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNCCTCGATTTTTAGCTTTATAGGAATGCTGTTGCTTT
AAATCCGCAATCCCGTGCCGGTATCAACTCTCGCGATCTCCGAGGCCGCATACATATTAC
CCACAATTCCCTTTCCTTTCTCTCTCCTCCCGCCGCCCAAGATGGTGAGTGAGCTGTAGT
TCCGTGGCCCTATAGCCAGGTTCCGGCTGTATCCGCTGCCATCCTCCTCCAGGCGCGGCC
TCGGAGGGCCTCCTGCTCCTCCTGGCGCTAGGAGAGCCCCACTCGGTGTGGCACGGAGAC
ACTGAGGTGGATTAGAGCCCCACTTGGTGTGGCACGGAGACATTGAGATGGACTAGAGCC
CCGGGCGGCCGAGAGCGGAATGCGTTGTTCCCGGTGTCGCAGGGCTGGGTGTCGCAGGCC
TGGAGCGCCGCAGTGCGGGGCTCGGAGCCCTAGCGTCTCTCGGGCTTGCTGGGGGCCGCT
CCAGAGGCCTTGTGAGCGACGAGTTCTGAGCCCGCCCCTGTTGCTTCTGGAGCCTGCGGG
GCCGCGACTCAGAGGAGTCATGAGTCCGGGGCGTCTCCTGGGTGGGCGACGCGAAGAGAG
CGTGGTCTCGGGCTTAGCCTTGCTCTGGCCACTCGGGGTTCCCAGGGCTGCATGCTTGTG
CGGCTGAATGTGAGATGCTCCTGTCGAGGGGTGGTGCTGGGGGGCTGCAGAAAGCTGCTC
GCCAGCCTAGTTCAGGCAGGTGCTGTCAGCGTCCCTTGTTTTGGAGGAGCCAGTCTGAGC
CCTACCCCCGACGAAGCGAGTGGAGGCGGCGGTTTAACTGACGTTTTCTTTCTGCCCAGC
CGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCTCCGGCCCCAGCTGTCGTGAAGAAGC
AGGAGGCTAAGAAAGTGGTGAATCCCCTGTTTGAGAAAAGGCCTAAGAATTTTGGCATTG
GTGAGTAACAAACGGCAGAATGAAAACGGTCTATGTTTTTCTCAAGGGAAGGTGGTAATT
AGGTTGTGTTGTATCTTGTAGGTTTTAGTGGGTGTAAAGTGGTCGCAGTCCTTAACTTGT
GTCTCTTGGAGACGGGGGCAATGATGATACATGCTTCTTGCTTTCATTGGGAGTTGCTGA
GCGAGCATTCAGCTCAATATGGTAGTGGCCTTGAATTCAGCTTAGCCATCTGGAAACAAG
TACAGTAGCAGTGGCGCAGCGAGATACTAGGACTGCAATTCTGTTGTACTTCGTGGCACC
TTGGCTTCTTGTTAGATGAGGAAAAGCATCGTGCTCTTTGTTCTCAGGTGTTTGTGTGCA
GATGATGTAAAAGAATATTTGCTATCTGAGAGATGGTGATGACATTTTAAACCACCAAGA
TCGCTGATGCACCAACACCCTTCCTAGTGGCCCCAGACATGAACTTGACATGGAATTTGA
GCCTCACTCGATGTCACCCTTTACTTCTCAGGACAGGACATCCAGCCCAAAAGAGACCTC
ACCCGCTTTGTGAAATGGCCCCGCTATATCAGGTTGCAGCGGCAGAGAGCCATCCTCTAT
AAGCGGCTGAAAGTGCCTCCTGCGATTAACCAGTTCACCCAGGCCCTGGACCGCCAAACA
GGTGAGGTTCTGTGGCGTGGAAAGGAGTTTCTCAGGCAAGGATTCCTTATTTCATCCAGA
ACATGAGGGGGATGGTCTTAGGCTTCTTGAACTGCAATTGTCATTAAATTATAGTCATAT
AGCAGGACCGCAGTCCAGCATTTGTTATTAAGTGTTAAGTGACAAGGATTAGAACCTTGA
CTCCAAGCCTAAACTGAAGAGTGTTTTTCCAGCTACTCAGCTGCTTAAGCTGGCCCACAA
GTACAGACCAGAGACAAAGCAAGAGAAGAAGCAGAGACTGTTGGCCCGGGCCGAGAAGAA
AGCTGCTGGCAAAGGGGACGTCCCGACGAAGAGACCACCTGTCCTTCGAGCAGGTGAGTA
GGCCCCACCTTAGGGTGAACACTGGGGGCGGGCTGTTGCAGTGATGTAAAATTTCTTCGC
CTGAAATTACTGTGAAGAGTAAAACCGAGCTTTTTAACACTGAGTCAACAGCTGAGCCCA
GCAGCTTCTTGTGATTAGAGCAGGGCCTGTGAGAGCTCACAAAGTGGTTGTGTGTTCTAG
GAGTTAACACCGTCACCACCTTGGTGGAGAACAAGAAAGCTCAGCTGGTGGTGATTGCAC
ACGACGTGGATCCCATCGAGGTGCGTTTGCCTGTTGACTGCTAACCCAAGGGCTTCTGGC
AGTACCAGGAAGAGAGAGTAGACCTAATGCCAAGTCAGTGATGGGACCGAAGTGGGTGAG
GGCAGTACTGACACAGATCCAACACATGCGTGGCTCTTGCAATGATGTGAATCTCTCACT
GAATTCAACCTTGAAGTGCGAATCCATGAGCTTTTTAACCCTGAGCAATTGTTACAAGCT
AACTGAAATTTGCTGCTTTTGGTCAAAATACAGTCTTCAGCTAATGCTTTCTTCCAGCTG
GTTGTCTTCTTGCCTGCCCTGTGTCGTAAAATGGGGGTCCCTTACTGCATTATCAAGGGG
AAGGCAAGACTGGGACGTCTAGTCCACAGGAAGACCTGCACCACTGTCGCCTTCACACAG
GTGAACTCGTAAGTGCACAGCCTGGCCCCAAACTTCCCCCCCAGTTCATTTAATCCATGC
CTCACAGTTGTTTCCTTTTGCCTTAAAGGCCAATCTTTTAGTTTAAGAAATATATTTATC
TGAACTTTTGCCAATGATGGTTAAGAATTTCTTCACCTGAATAAACCATGTGGTCAGCAT
TGCATCTGAGGCAAAAGACTGTCTTGAGCTAAAAGGTATTTTTGCATTCTAAAAGGGAAA
CTAAGGCAAAAAACCCACTTTTGTTTTCCCTCCTGCCTTTTTAGGGAAGACAAAGGCACT
TTGGCTAAGCTGGTGGAAGCTATCAGGACCAATTACAATGACAGATACGATGAGGTAAGA
GGCAGCTTTACACAAAATACTGTCATGCGCAAATCTTTCTCCCAAATAACTGGCTGGCTT
AACCTATGAGAAGTTCTGACGATCAGCTTGGAACAGCCAAACAGAATAACGCAACTAATA
ACCTTGAAAATCTCAGAAAACAATAAACCAAGCTAACTGCCTCTTTTTGTCTTTTCAGAT
CCGCCGTCACTGGGGTGGCAATGTCCTGGGTCCTAAGTCTGTGGCTCGTATCGCCAAGCT
CGAAAAGGCAAAGGCTAAAGAACTTGCCACTAAACTGGGTTAAATGTACACTGTTGAGTT
TTCTGTACATAAAGATAATTAAAATAATACAAATTTTCCTTCAGCCAGTGTCTGTTGAGT
ATCTCGGGTTGAATCTTACTTGGGGTTAGCAAGTATCCTTTTTTTGAGACACAGCCTCAC
TCTGTCGCCCAGGCTGGAGTGCAGTGGTGTGATCTCAAAGCAACCTTCGCCTCCCAGGTT
CAGGATATTCTGGTGCCTCAGCATCCCAACTGGCTGGCCGATATTTGTGTTTTTGGTAGA
GATGGGGTTTCACCATGTTAGCCAGGCTGGTCTGAGCTCCTGACCTCAAGTGAGCCACCG
CACCCGGCCCTTCCCACCCTTAAATACATTCTTAAACCAGGCATTTTGTTCCCTAGAGAT
GTAACTTGCATATCAAGTTTTGGGAAAGTTCTTTGGACTGAAACCAAGCCAGGATTTTAT
GATCAACCAGTCATGAGCTCATTTAAGGTACAAGGCCAGAACTTTATACCAATAGCACAT
GATCCAGCATAAAGGCAGTCTTGAAATACTGCATTATCCAGGGACAGGGCTTTAGCAGCT
GATCTGTCACACACCAGGTGTCCCACGTAGGAATTTCTTAAACCACAGGTAGGATGTAGC
TGCAGAGAGTCCATACCTAGGGGTTGAAAGCAAGCCAGCATTAGCAGGCTGCTAGGCTGA
AGGGGAGGAAGCCAGAGGGCCGCTGGGGACTCACCAGGTCACGATGTACTGCAGATGCTC
GTTCCTCAGAGTAACTCTGGTTTGCCCTCCAATGGGTCCTCCAGGGACTGTGCTCTCTGT
GGAGACAGCAGACTCAAGTCCACCCCCTACTGCCTGCCAGCCTCTGCACCACTTCCTAGC
GGCTGTCATTTTTGCGTGGCCAGTTGGAAGTCCTGTATGGCCTTTACGTTGGGTGACCAT
CCCTGCCCTTGTCCGCTCAGTACTTGCCTAGGTTCTTCTTTGCTGAGTTGCTGCCTCCCC
CCACCCGCCATATACACATGTGAGAACATAAACCACAGCAGTGACTGGGCAATGAGGGTT
AGGAGGAAGGACAGTATTCACAAAAGCTACTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 1679..1799, 2311..2460, 2672..2812, 3000..3079, 3357..3487, 3764..3833, 4018..4191
1001..1003, 1679..1799, 2311..2460, 2672..2812, 3000..3079, 3357..3487, 3764..3833, 4018..4119
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved