Pan_troglodytes Locus XR_023205.1
snOPY snoRNA Orthological Gene Database
Pan_troglodytes XR_023205.1
Pan_troglodytes
XR_023205.1
9
SNORA65
3795..3924
5754
CAGGCCTGCAGAGCCAGTTCAGGCCCTCTTGTCACCCCACCTGCCTGCAAGGATGGGGA
ATGGTTTGAAAACAGCCCTCCCCCATCCGTCCCTGATGACCAGCACTTACCCTTCTGCTC
CCCAATCACTAACCCTCTTGCACCCCCTTCCTGATGTGCAGCCCTCCCCACTTCCTCCCA
ACCACCATCGCTCTCCCACCCCTCCCCGAAGATCAGTTCTTTCCAGGCTGCCCCACATGC
CTGTCCCTCCCTCTCCGACGTCCAGCCTAGATGCGGGGGGAGGGCCACACCCATATTTCC
TGGGATGGGGTCTGCAGTGGCTGACCTGGCTTTGCAGATGGAGGGGTCCCCCACGTTGGG
ACCCGCGGGTGCACCCGGGGGCAGGCCGATCACTCGGAGGGCTTGGTCACGGACTCGGGG
CCGCAGACCACTCGGCACGGGCCCGGCGGAGCCGGAGTCTGGTCTCCTTCAAAGGCAGGT
GCTGGGAACAGAAACTCAGAATCTCATAAAGTCACGCAGACCGGGATGACGAAGTCTGAG
GCTCTAGGAATCGCGGACTCTCCGAATGAAGAGCGGGACTGGATTTCCACATAGACTGTT
TTGATAACTAAAGTGCACACAACAAGTGCTCGAGGGAGCAGGGGTCGCCGCGGTACTGGG
GTCTCGGAATGGGACTACGGACCCCTCAGGGGAGGGGCGGGGCTCTGGGATTGGGTGACG
GGGACCGGGGTGACACTCACGATAAAGGAATATGGGAAACAGCTAGGCCTGGGATCACCG
GAGCAACCCCTCTTCTCAGACTTCTCCGGAGCGAACTACCCGAACCCCCTTTCGGAATCT
CTAGCTTCAGCGCACCGCAGTGCCCTGCTTGCCAGCCGTCAGCCTCAGGCGCCTGCCCAC
AACAAACATGGCGACAAGGGCGTCTCTGGAAGGCCGGGCAGTGACGACAGTTCTCGCGAT
GGCCGCGTTTTCCTGCCTATATCTGGCTTGTCCGCGCGATTTCCGGCCTCTCGGCTTTCG
GCTCGGAGGAGGCCAAGGTGCAACTTTCTTCGGTCGTCCCGAATCCGGGTTCATCCGACA
CCAGCCGCCTCCACCATGCCGCCGAAGTTCGACCCCAACGAGATCAAAGTCGGTGCGTGC
TCTAGTTGTGGCCGGGGCTGCGGGATGGAGCATCCCTCGGCCCCGCCGCGCGTGCAAAGC
TTTTCCCGTATGGGGCTCTTAAAGCCGCTGCCTCCCAGAGACCTTCCCGGTGTTGCGCCG
CCCCGGCCAAGCCTCAGCCTTTCTGGGCCTTAGCTTCTTCACGTGTAGGTGGGGAGGGAG
GACTGGACCACCTGTGGCGGCTTGGGAGCCCGCACGCCCTAGGGTAAGGCTTGTCTCCGG
GCGTTTCGCCCCACTGGCCTGGGTTCGCGGGCGACGGGGCTCTCTCCACGCCTCCCCGGT
GTGAGTTTCGGAGCTGCCCACACCCGAGGGAGGAGCGGGTGGCCCGCCTCGCGCTCTGTG
CTGTTTCGAGAACAGGCAGAGGGTGGCGTGTCCAACCCCGGAAAGACGCTGAGAGGGCTG
TGGCTCGGGGCTCCCTCTGCAGAGACACTAACTCTTCTTTTCCCCCAGTATACCTGAGGT
GCACCGGAGGTGAAGTCGGTGCCACTTCTGCCCTGGCCCCCAAGATCGGCCCCCTGGGTC
TGGTACGTTATCCCCTCCAAGGGGCATTTTTTTCACATTTGTTTCACTTTAAGCGCCGGC
TCGTGGAGTCACGCCTGTGCCAGAGGTGCCCTCGTGGCTTGGACTGTCACCCTCAGTAGG
CCTGAGCCACTGAACTAGTACTAGGTACCTTAGGAAGGTCGTGTGTGAAAAATCGAACCC
GCTGTCTTTAAATTGTAATTAGCTCCATGTGTCTCCACTGCTGCTTTGGTGTACCTGAGG
GGTGGGCCCAAGGGGGAGTTTTGAAGTTAGGACTGGCTTAGAGACATTGGGCAGCCAACA
TCTGTATTTCCTCGTCAGGAAGTGGGCATGGCGTTGTTGGTAAGATTAAACGGGGTGTGG
GTGAAGATCCAGCGAGCGTTTCCAGCTGTGTTGTAGATGTAAACCTAGCAGTTAATGTGG
CAGGCTGTGTCTCATGCCTGCTGAGCAACTGCTGGCTTCCCCGTCATTCTGGCCTCTTGG
ATTTCTCTGAATTTCATTAGGCCTTTATTTAATCCTTGCACAATGCTCCCCTGCCCCAAA
TGCTCTTCCCCATTGGTCTTTTTTAACGTGTATCTTAACTATTCTTCCTTGGCCGTTAGC
TGGCACTTAAGGGACACTTAGCCTCCTGTTGAGGCTAAGGATTACTAGAGGAGGAGAACT
TCAGAGTAGCAAATAATCAGACCTCCATCCAGGAAGATGGACGTGGGTGGTCTGACATGG
GAGCCTAGTATTTTGAAAGCTCCTTAGGTGATTCTAATGTCAGCAGGGCTGAAAATCCCC
CTCCTTAAGCACATGGGCACTTAGGAGGGGGTCTAGGTTACATTGTGGCCAAGTCTGCAG
TTTACAGTTCTGGACAAGATAACCCCAACCCCCAATTTATGCTATGGTGATAGCTGTGCT
CTGATTGAGAAGGTGCCCTTAGGTACTTGAGATAGCTTCCTTTGTTGCCAAGTGAGAAGT
GGTGGGCAGGTTTCAAGGCTGTGGTTCACCTCTGGACACCATGTTGATTACATGCCTTTA
TTTCTAGTCTCCAAAAAAGGTTGGTGATGACATTGCCAAGGCAACGGGTGACTGGAAGGG
CCTGAGGATTACAGTGAAACTGACCATTCAGAACAGACAGGCCCAGGTATTTGCTTGTGC
TTGGTTTCGGGAGAGGAGGGTGGGGGGACAGAGGTAGCAACCCTCTGGGATTCCTGAAGA
GTATTTATGCCACCAGTGGTGAGCAGAGAGTGATTTTACCTTGTTGGGGAGGCTTTGTCA
AGAGTACGGACCTAGGGCAAAGACTTGGACAGTGTGTGGCCATGATTTTTGAGAGCCAGC
GTGCATGGCAGTATTCACTGGAGGTGGAGTATTCACTCAAGAATCTCTTCTGCAGATTGA
GGTGGTGCCTTCTGCCTCTGCCCTGATCATCAAAGCCCTCAAGGAACCACCAAGAGACAG
AAAGAAACAAAAAAACAGTGAGTTGTCTTTTCCCTAGTTTGGTTTTGGTAATGGTTTGTG
AGATGTTTGATATATGTGGCTGTGTTTTCCCTTAAAGGAAACCTGGGGTTGACATGGGTA
TTGGGTGTTGATATGGTTAGGGCTGCTAGAGCCAGGTAGTATCAAAAAGTGCCATGTATG
CTGGGTGGCTCACACCTGTAATCCCAGCACTCTGGGAGGCTGAGGCGGGTGGATCAATTG
AGATCAGGAGTTCGAGACCAGCCTGGCCAACATGGTGAAACCCCATCTCCACCAAAAAAT
ACAAAATTAGCCTGGTGGTGCTCGCCTGTAGTCCTGGCTACTCAGACGGCTGAGGCAGGA
GAATCACTCCAACCCAGGAGGTGGAGGTTGTAGCAGTGAGCCAAGATTGTGCCACTGCAC
TCCAGCCTGGGTGACAGTGAGACTCCGTCTCAAAAAAAAAAAAAAAAAAAAAAGTGCCAT
GTAGTCCCTGTGTGGGGCAGGCCCCAATCGGTGCATGTGGGAGGAAGGTGTCAGCAATAA
TGACCTCTAATCAGGAGACCACATACAGCTGGCAGGTACTGGGCAGTTTAACTCCCTGGC
AATTTAAGCTTGTCATTTCTCTAAAACAGTTTCTGCCATGTCAGATTTGTGAAGGCTTGG
TTTTGCCCTCAGCCACCCGCCACTGCACCTGACCACGTCTCTGTTGGCTGGTGCAATCCA
GTGGTGAGCTGATAGTAAACCCCAGCTTAGGAAACAGGGTTGTTCTTCATGTGGACGACT
CTGTGCCGAAAGCATGGGAACAGCCTAGAAACAAAATGAAGGACACATGATCTGCTTTGG
CTTCAGACTTTAAAAGAGCTTTTGCTGTTTCCTCTTCTGCAGTTAAACACAGTGGGAATA
TCACTTTTGATGAGATCGTCAACATTGCTCGACAGATGCGGCACCGATCCTTAGCCAGAG
AACTCTCTGGTAAGAGCAGGACAACATGTAACCGCCGTAACTGTGGTTGTATTTTTCACT
GAGTGATAACATTCTTCTTACTTGAAGGGTGCTCAGTGAGACCCAAGATGGGGTGCAGTT
TTCTGGGACTGAAAGGATGGATCGTAAATTGGATGTGTTTAATCTGGGCATCAAGGACCC
ATGGAAGCTTTGCATTCCGGGTTATGGAACTAGATGGAGCTCTATATTCTATATTAGGGG
AGCAGGAACCTCATTCCTTCCATTGCCTGCTATGAACCCTTTCAGTATTCCCCAGTATCT
GCGGATTGTGAGGGACTGAGCCAGCACCTCCAATGCCACCATTTCTTTACTTAAAGGAAC
CATTAAAGAGATCCTGGGGACTGCCCAGTCTGTGGGCTGTAATGTTGATGGCCGCCACCC
TCATGACATCATCGATGACATCAACAGTGGTGCTGTGGAATGCCCAGCCGTAAGTGACAT
TTTCATTGTTACAGTAGGGGTGAAAGGGGGGCCACCCAGTGTATTCACAGAGATAAGCTG
GGAAGTTTTGGAAATGGTTACTGGTGGGGTGGGATAATCCTTTTAAACTTCTTACTGATT
TTTTTTTTCTTCTTTCCCACAGAGTTAAGCACAAAGGAAAATATTTCAATAAAGGATCAT
TTGACAACTGGTGGATTTTCTGGTGTGGCGTCTTCCTTGAGGGAGCTAGCTCCTTTGTGG
GGTGGTCAGTGGGGTCAGGGTGGCAGAACCTGTGGAGAAGTAACAAGCACCTTGTGGTGG
GTAACAAAACTGCCCTGTATGGGCTGGGCTGAGCTCAGAAAGGAAGCCTTTCTTTCCTTT
TTTTTTTTTTTTTTGAGACAGAGTTTCGCTCGTTGCCCAGGCTGGAATGCAATGGTGCAA
TCTTGGCTCACCACAACCTCTGCCTTCCAGGTTCAAGCAATTCTCCAGCCTCAGCCTCCT
AAGTAGCTAGGATTACAGGCACGTGCTACCATGCCCGGCTAATTTTTATTTTTAGTAAAG
ACAGGGTTTCTCCATGTTGGTCAAGCCGGTCTCGAACTCCTGACCTCTTGATACGCCTGC
CTTTGGCCTCCCAAAGTGTTGGGATTGTAGGCATGAGCCACCATGCCTGGCCACGAAGCA
CTTTTTGTAGACTATCATGAAGCCTTTCCTAAGAAATAAGCTCTAACAAAACCGGAACAC
ATGGGGAGTGTAGCTCTCCATCCCCAACCAACTGAAGTTATGAGTGGGTTGGGGGCCCAG
GATCTATTTTGCTAGCCATTCCAGTGCACAGCCAGGGCTCAGAACCACTGACCTAACCAC
TCTCCGAGTCCTGGACTAATCCTTTGGTCCTGTGAAAGTGAGGTTCACGTCATCTGTTGA
AGTAACTATAAACGGTTACTCCAACCTTTCCTCTGAACTAGTGGCTTAAAGTTATTTTCT
GCTGTCTCACGTTTCTCAAGTCTCATCTTCCCACAGTTCTGTTCCTTCTGATGAACTTTC
TAGAGCCTGTGTTCATCACTCCCTTTTGTTTTTGCGATGAACCCTAAAGCACTCCTGAAC
AGCTTGAAGCACCACCTGGGAGAGGATTCTGGGTACTGGAGTAAAGGGAGTTGGAAGTTG
TAGCCCAGAGAAATTGATTTCCCCTATATGACTCATTTCTTTGCACATTAGTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1131, 1608..1681, 2707..2805, 3055..3136, 4002..4088, 4436..4548, 4702..4754
1095..1131, 1608..1681, 2707..2805, 3055..3136, 4002..4088, 4436..4548, 4702..4704
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved