Pan_troglodytes Locus XR_022087.1
snOPY snoRNA Orthological Gene Database
Pan_troglodytes XR_022087.1
Pan_troglodytes
XR_022087.1
8
SNORA72
5266..5397
6772
TAATTTCTCATCAAAGAGGGGCACACACTTGAATGAATGTTATTTTTATTATTTTAAAA
TATATTTTATTTTATTATTAATTATAATAATTAATAGTATGTTAATAGTTAAAGTATAAT
AGTAATTATACTATTTTTTGAGACGGAGTCTCGCTCTGTCACCAGGCTGGAGTGCAGTGA
CGTGATCTCTGCTCACTGCAACCTCCACCTCCTGGGTTCAAGTGATTCTCCTGCCTCACC
CTCCCAAGTAGCTGGGACTACAGGCACGCGCCACCAAGCCCAGCTAATTTTTGTATTTTT
AGTAGACACAGGGTTTCACCATGTTGGCCAAGATGGTCTCAATCTTTTGACCTCGTGATC
CTCCCGCCTCGGCCTCCCAAAGTGTTGGGATTACAGGCGTGAGCCACCGTGCCCGGCCTT
ATTACTTTTTTTGAGAGGGAGTCTCGCTTTGTCGCCCAGGCTGGAGTGCAGTGGCCCGAT
CTCAGCTCACTGCTACCTTTGCCTCCCAGGTTCAAGCGATTCTCCTGCTTCAGCCTCCCA
AGTAGTTGGGATTGCAGGCAGGAGCCACCACACCTGGCTACTTTTTGTATTTTTAGTAGA
GGCGGGGTTTCACCATGTTGACCAGACTGGTCTCGAACTCCTGACTTCAGGTGATCCGCT
CACCTCGGACTTCCAAAATGTTGGGATTACAGGCGTGAGTCACCGCATTTGGCCTGAATC
AACTTTAATTGTGAAGAGACCTAAGTTACCTGGGCTCTGGTCCTAGCTCTGACAATAGCC
CTAGATATGTAAAATGGACAATAAAAAGGTTACTATCTCATGGGACTTTTGTGAGTATTA
AATAAATACATGTAAATGATTCCTGGTACAGCACGCGTTTTTTGGTGAGGCTTAATTAAG
GAGGGGAAGAGGTTTCCCTCATATAGCTTACCCACTGGTCTGATTGATTAGGTGGGGATT
TTCAGCGCCTAATATCTTCAGTGGTCTGTCTCTGGACATTTATACCAAGATCCAACGTTA
ACAGCAAAAATACTTTTAAAAAATTAGACCTGTTTATCGCGCTCTCAGTGCAAACTCGGC
TCACAAGTTCACGCTAACACAGTCCCAAAAGGCGAGTTTTGGGAAACTCGAGCAGGGCGC
CACCGTTCTCCAGGGGACAGGTAACTTGGGTGACCGCAGGGGTGAGGACACAGCTGCTTC
TACCAAGCGGAGAGTAAATGCGGGTGCTGCGGCGCATCGGAGTCACCCACAAGGCTCTCC
AAGAGCCGCGCCTCAGGGCAAAGATGAATTCAGCGGCATTGAAACCGTGGTCGCAGCCGC
CGCAACCTCTTCTCATCGACCCTCCCACCTCACCTTCAGTCGGCTTTTCGAACTCCCTCC
GGGTTCTAAGCGCCTCGATTAGTTAGACCGCAGCTCGCAGCAGAACAGCAACACAACGCC
GCGAGGCTTAAAGGCCCGCAGAGGGGGATGCGAACACCCCCGCCGTCATTCTTTTTTTCC
TTGAGACAGAGTCTCACTCTGTCGCCCAGGCTGGGTGCAGTGGCGCGATCATGGCTCACT
GCAGCCTCGACCTACCGAGCTCAAGCGACTCTCCCGCCTCAGCCTCCGGCGTAGCTGGGA
GTAGCTAGGACTACTGGAGCGCGCCACCACGCCCGGCTAATTTCTTTTTTATTTTTTTGT
AGAGACGGGTGGTCTATGTTGTCCAGGCTGGCCTTGAGCTGGACGCGACAGATCTTCCCG
CCTCAACCTCCGAAAGTGCTGGGATTAAAGGTATGAGCAGCCGCGTACAGCCCCCGCAGC
CATTCTAGCTAGCGGTACCAATAGCAAAAGGCAGCTGCCCTCCGCTTTTGCTCCGCCCCT
TCTGCTTGCGATCTGTTTCCGCTTCCGGTCCCGCAGTTCCGGCTCTGCCCTGAAGAGCTT
TGCATTGTGGGAAGTCTTTCCTTTCTCGTTCCCCGGCCATCTTAGCGGCTGCTGTTGGTG
AGTGGGCTCCTACCGACCGAGGTTTAGGCAGCGCGGGGAGCTTTGCGGGTTGCCATTTGT
AACTCCGGATCCTAAACTTCCTGTCCTGTTCTCTGTCTCTTCTAGGTTGGGGGCCGTCCC
GCACCTAAGGCAGGAAGATGGTGGCCGCAAAGAAGACGGTGAGTGAGGCGGGCCAGGCCC
GGAAGACGATTCACGTGGAGAGATGTCTCGGCCAGGGCGGGCAGATGTGAGCCCACGGGG
GTGACAGCATGCCTGCTGGCATTTGGAGGGCCCCAGAAGGAATCCCAGTGGCTCTCTCAA
TGACTTGGGGTCCTCGACTTCGGAAGTTTAAGGGGCTCGGCTTCAAAAAGCTGGGTCCGG
TTTTGAGGCGGTTGCAGGCGAGGCCCTTAGGTCCGTATTTAATGTTTGCTTTGTAGAAAA
AGTCGCTGGAGTCGATCAACTCTAGGCTCCAACTCGTTATGAAAAGTGGGAAGTACGTCC
TGGGGTACAAGCAGACTCTGAAGATGATCAGACAAGGCAAAGCGAAATTGGTCATTCTGG
CAAACAACTGCCCAGCTTTGAGGTAATCGAAGAAACTGAACGGGCTTCGCCTACCGCGAA
TTCATCGTGAACGAATATACAGGAGTGTAAACTTGTAATCTGAGTACCATGAACTCGAAC
ACTTGCAGGATAATTACGGTAGCGATTGTGGTGTTTGGCCCTTCATTCCCGTCTCCCCCA
CCCACCCCCAAATCATGTGCTCCCCTTGTGCGAGCTTATTTTTGGAGGAGAAATGTGTGT
GTGGCAGGATTGAAAACAGAACATCGAGGTTTAATGGAAACACAGACACATTATTTGTTT
TTTCCATGTATTTTGTGTCCTGCTTTTTTGGTTCTTTTAGCTTTGAGGTGCTTTAATGAT
GCTTCATTGTGTGAACTTGTTTTAGTGTCAAAAAACTAGGTAGGAAAAGTTGAGGCTGGG
CTATGGAGTTGCAGGCTATCATAGAATCACCTAGTTTAGCCCGCTAAATCAGTTCTGAGT
CAAGATTTACGCTTGACTCACTGTTTTGAAATTGAACTTAGGGGGTGTTGTAAATAAGCC
AAACAAACTTGGACCTTGCAGAGTATAAGCTATGCGACCAAATTTTCTGTGGTGATGCAT
AAGCTGCTTACAGCATTTTATATAGGGTGTCTGTAATTACTGTCAAAGCCTGGAGGGCCC
TTTCTGTCTCGTCCCATGGGTTGGGCTTTTCCCTAACCATTCTTTGAAACTTTCTTTAAA
GCCTGTCTTCTATAGTAGTGCTTCTGAAACATGACTGTGCAAAGGAGTCACATGGGTGAT
GTTAAAATGCAAGTTCTGATTTCATTGGATTTGGGATGGGGCCCGAGGTGCCGTTTATTA
TTTTATTTTATTTTTTTTAAGACAGAGTTTTGCTCTTGTCACCCCGGCTGGAGTACAATG
GCACAATCTAAGCTCACTGCAACCTCCGCCTCCCAGGTTCAAGCAATTCTGCCTCACCCT
CCCGAGTAGCTGGGATTACAGGCACCTGCCACCATGCCTGGCTAATTTTTGTATTTTTAG
TAGAGATGGGGTTTCGCCATGCTGGCCAGGCTAGTCTCGGACTCCTGACCTTAGGTAATC
CACCCACCTCGGCCTCCCAAACTGCTGAGATCACAGGTGTGAGCCACTGTGCCCGGCTTG
AGGTGCTTTTTTAACTAATACATTGTAGCACTATTGCTGGTATGTGGATCCACATAATTG
AGTGGCAAGATAGTATAGGACTCCTTTCCGATTCCTAAAACCATTAGTATCTACTAAATT
GACGCTGAAATTTTGTATTTTTAGTAGAGACAAGGTTTCACCATGTTGGCCAGGCTGGTC
TGACGCTCCTGACTTCAAGTGATCCGGCCTCCCAAAGTGCTGGGATTACACGCGTGAGGC
CAGAAATTTTAACTCTAAAACGGTATCACTTCCCATCTGGAATTCTGGGCACTGAGGGGA
TAGTGATAGAAATGGCTTATCTTTTAAAGGTTTAGATTCTGGATCCTCCACTTACTATTC
TGTGGCTCAGTTTCATTAGATTAAAAAAAAAAAAAAGAATAGGGCTGTGTGCCGTGGCTC
ACACCTGTAATCCCAGCACTTTGGGAGGCTGAGGNGGGNGGANNCCTTGAGGTCAGGAGT
TCGAGACCAGCCTGGCCAACATGGTGAAACCCCGTCTACCAAAAATATAAAAAATTAGCT
GGGTGTGGTGGTGCATGCCTGTAATCCCAGCTACTTGAGAGGCTGAGGCAGGAGAATCAC
TTGAACTCGGGAGGTGGAAGTTGCAGTGAGCTGAGATCGTGCCACTGCACGATCTGCCTG
AGCGACAGAATGAGATTCCATCTCAAAAAAAAAAGTATATAATACCTACTTTAGAGATTG
TCATGGAAATATAAAGTATGTGGTCCTTACTAATGCTAAATAATGCTTTGCTTTCATTTA
TTTGCATCTTACCCTCTTCCGTGAGTGTTGATACTGTCTTAAACATAGTAGGGGTTGAGT
AGATATTTGCTGGTTGCCCCTTCACTTGCAAGGGATACATACAAATGTTGGTTTGTATTG
GATAATGAATGTGATGTTTTTAAGAGTAATATGTGATTTTGTTACTTTTTGAAGGCCTTA
ACAACATTAACACTAGTAAAAGAAGTAGTAACATTTAGTCTGTCAGTCACTTGGTATCGC
ATTTATTTATTTGCCCTTTTTGGTTCCCAAAGGAAATCTGAAATAGAGTACTATGCTATG
TTGGCTAAAACTGGTGTCCATCACTACAGTGGCAATAATATTGAACTGGGCACAGCATGC
GGAAAATACTACAGAGTGTGCACACTGGCTATCATTGATCCAGGTATGCTTTTTAAATCA
TAAAGTCTTTTTTTTTTTTTGCCTTTCTAATGTCTGGACAAGTATTTCTTACTACGCAAA
TGTCTTTGGTTCCTAAATTCAGATAGAATATGGATCTAGCAAGGCATATCGTGTAGTTGT
ATTTTGTAGAGAATTGGTAATGAATGCCAATACATTATAATTGGCTTTATTATGAGTTAA
AATTTTTACTGTCAGATAATGAATTTCATTTGATGAAGTACCTATGAAATAATGACATAG
ATTTGGTAAAAGGTGAAATTATAAGGAGAGAATAATCTGGCAAAACAGAAGAAAGTAATT
ATTGCTTCTTGAGAACAGACATGTAAAATTAGCTTGAGAAAAAAAAAAGTGCCGAAAAAT
CTACATGATTCTGTTTTCCAATTGTGAATCTTTGATTCATAGAATACTGCGAATATTCTC
GCTGTTCTGATTTTGTAATAGTCAGGACAGGCTAAACATTCGCTATATTAAGACCATGCA
TGTGTCCCCAAACCTAGTTCTTTCCCTAGGTCTGGTTTTATAAATGCTGGTGATAAACCA
ATTTTATTATATGATCATTTTATGTGATTATATAATGGCTGTGATTCTAGGTTATCTTTG
GTCAACCTTAAGAAAAATGACAGTACAGCTAATGTGATAACTTTTGCAACAAGTCAGTGC
TAATTTGCAGACCATTGTCTACAGAAGGGATAACCAAAGGTAGAGAAATTTTATGGTACC
AGTTGCTATTAAATGAATTGTAAAATTACTGGGTTTTTTTTTTTTTTTTTTTTTTTTTAG
GTGACTCTGACATCATTAGAAGCATGCCAGAACAGACTGGTGAAAAGTAAACCTTTTCAC
CTACAAAATTTCACCTGCAAACCTTAAACCTGCAAAATTTTCCTTTAATAAAATTTGCTT
GTTTTAAAAACATTGTATCTATTTCAGTATTTTTCTCTATTTTTGTTCAATACAATTTCC
TGAAGGTTGGATTAGAGAGGATGAGGCAGATGTGGTGGCAAGACTTTTCAGTAAAGAGTT
ACACATCCTGGGCCGGGCATGGTGGCTCACGCCTGTAATTCCAGCCCTTTGGGACGCCGA
GGCGGGTGGATCATGAGGTCGGGAGATCGAGACCATCCTGGCTAACGCAGTGAAACCCCA
TCTCTACTAAAAGTACAAAAAAAATTAGCCGGGCGTGGTGGCGGGCGCCTGTAGTCCCAG
CTACAGAGCTTGCAATGAGCCAAGATTGTGCCACTGCACTCCAGCCTGGGCGACAGAGCA
AGACTCCGTCTCAAAAAAAAAAAAAAAAAAAAGAGTTACACATCCTGATTTCTGTTTTCC
AGGGTTTTTTTGTTGTTGTTGTTCTTTTTTTTGGAGACAGTCTTGCTCTGTCGCCCAGCT
TGGAGTGCAGTGGTGCAATCTTGGCTCACTGTAGCCTCCGCCTCCCAGGTTCAAGCGATT
CTCCTGCCTCAGCCTCCTGAGTAACAGGGACTACAGGTGCGCACCACCACGCCTGGCTAA
TTTTTTTTTTTTTTCGTATTTTTAGTAGAGACGGAGTTTCACCATGTTGGCCAGGATGGT
CACGATCTACTGACCTCGTGATCCCCCGACCTCGTGATCCCCCGGCCTCAGCCTCTCAAA
GTGCTGGGATTATAGGCGTGAGCCACTGCTCCTGGCCCAGTTTTTGTAAAGGGAGTGCAC
TGGGTTCCTTTCTAGTACTAGATGTTTAGAAAGCTCAAGTTTTGTAATTCCATTCTCAGG
ACATTGTTTGCATTTTATATTCTAGTATGCTTAGGAGGCAACAAGGTTAAATACCCAGAA
TTGCAATTTACCAAATCTGAGTAGCTAAAAAAGATTAACTGAAATGTTTCCCCATCCAAA
ATGCTGTCATAGGTTAAGAAAAGTTTTACTTTAATGAATAATCTTTCCTAAGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1133, 1931..2061, 4232..4377, 4636..4688, 4797..4893
1084..1133, 1931..2061, 4232..4377, 4636..4656
NC_006475
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved