Pan_troglodytes Locus C17orf45
snOPY snoRNA Orthological Gene Database
Pan_troglodytes C17orf45
Pan_troglodytes
C17orf45
17_random
SNORD49, SNORD49, SNORD65
1343..1414, 1875..1945, 3065..3137
4868
TCCGTCTCAAAAAAACACAAAAACGAACAACAACAACAAAAACCCTACACTTATTTCTG
AGGCCAGCTCAAAAGGTCTTATGATTGTCTTCCCAGTGTTTTGCAGTCAAAATGAATTTC
TTTCCCTTGGTATAACGTGTGTGTGCAAAACGTGGTTGCATGGATTATTTTTCAAGGAGA
GAGCTGAGCATGTTCATAGGCTGAAAGGAAAGCCACAGTAGAGTTTTCCATGGAAGGTGA
GGCAGGGGCATAGGTGGAGGAGGCCCCAAGGAATGAGGAGAGGAAAGGAGGTGGGCAGAG
CTTTACCCCAGAGGCGAGCAGAGGACGGACGTGGATCTAGATAAGACGTCAGCTCGTTCC
CTAAAGGTCGTGCTAAAGGAGTAATGAGGGTGACCAGTGCGCAGGGGTTTGAGAAGCCCC
GTGGATGTGGTGAAATAGCTGTGGGGAGAGTATTTGGCAACACTCAATAGATTCAGGAGG
AGCTACTAGGATGAATGGCTGCCGTGTGCCACAGCTCTACAGGCTTTCACGTGTGTCATC
TCACGTGATCTTCTGGGGCGCTGGTGTCTCCGTTTACTAGAGGACCAATCGGAAGCTTAA
AGAGAATGAGTAATTGGCCCAAGACCACCCAGCTAAGGAGTGGCGGAGGTGGGGCCCAAA
CGCGCGATCCAGCCCTCGCGCAGGCGCCCTGGAGCTCCCCGCGCGTGTTGTGACCCAGAA
TTCCCGGGGCTGTGGAAGAGACCATAGACTCAACAGGAGGGGGAGTCCTGGGTAGCGCGC
CGGTCTACATCGTTACTTGGCGGAAAGTTCCCATGAGTCTTTGCCAGCGTCCCCCTCCTT
TTGTGAGGAATGGGATATTCCGACTCCTTAAGGGCCAGGCGCACATAAGGTGTGACCTTT
TCATTCCCGTTGTTATGGAGGTAGGCTCTCTAGGAATCTGGGAGTAGTAGCTGGGGGGCA
AGAGCAAATAAAGAGCTCGGGCTTCTGTGGTCTCTGGGGAGATGTTCCCGGGAAGCCTGG
CTAGAGGGCGGAGGGCAGCTGTTGAGATGGCGTGGCTTTCGCGGCGGGCGCTGCGGCCCG
GTGTTGGACAGCCTGGCAGGGCAGCGCGGGGCCGAATCCGGCTGCCGTGGCTGAGGCTCA
TGGATCACTCTTTTGTGGTAGGGCCACATCTGCCAGAGCCTGGAGTCTGCGAAGGCCGGG
ACCCGGTTCCCCGGCCCACCGTGGGGGGGGGTGTGCAAACCCGAGAGAACTGGGTAAGTT
GGGGTCGGCTTGCAGTTTGGGGTACCCCGAGGGCGGTGTACGTCGGTAAGATTGTAACAG
TATTACTGGAAGATTTATTCGACTGTCCTGATGATACTTGTAATAGGAAGTGCCGTCAGA
AGCGATAACTGACGACGTCTAATGTCTATCTGACCGCAGTCGCTGAAACCTCTACAACTT
AGTTGACCGTAACTGCCAGAGCCCTGCCCTGAATTCCTGTCCTTACTCCCTCTTTAAGAT
TGCGTACCCACTGCAGAGTGCTGAAGACGGGGTAGCCACGAGGTAAGAGGCTCTCTGGTG
TAGGGTTTAACATGGAACGTAGTTTTGTCATCTTGAATGCACGGAAATTGGCGTTTTGAC
AGTTTTCTACGTTTAGGTGTTTTATACACTTTAGGGTAACGTTATCAAGTCATTGCATAG
GGTGGAACTTAAATAGAAACTGGAGATGGCTGCTTCAGCCACAGTCCTAACCTAGAACTG
CATTTAAAGCAAACTGATAATGCAGAAACAAACTCCTTCGTTAAGAAATGCCTCCAGTAG
CAGGGTTAGCTTAAGTTTCATGTAGGGTCTAGATCTGCGGTTGGAGCAGTACTGGAGGGT
TGTGAGGTGCTTGACTGCTCTGATGAAATCACTAATAGGAAGTGCCGTCAGAAGCGATAA
CTGACGAAGACTACTCCTGTCTGATTGCAGTCAAGTCTTCACCACTTGCTGGTTCCCAGG
AGTAAACTTGTCTGAACGGTGACCTAATTGCTATATTCACCTAGGTTGCAAATTCGTGAA
GAATCAGCATCATGTTTGGCAGCTGAGTATTGGAGCCAGGAGCCTGCCATGAGGTAAGCC
TTGCTCTATGGGGAGGCTAGTGGCTGACCACGCCTAGCTGTCAGGTCGAATATTGGCAAT
TGGATTTGGTTAACCTAATACCTTGTAACAGTGTAGCCTATCCCAGAGATACTGATTTTA
GTTTCCGGTGGCAGTGGAGCCAGGGTGGATTACCTAGAAAGAGGGGCTACTCTATTTACC
TCTTGGCTGTTTAGTCTTGGGCAAATTACCTGTCTGCTGAGATGTAGTTTTCCTCAGATG
TGAAAAAGAAAAGTAATCTTAGCTTTGTGAAGTTTAAATTGATGTGACTGAAATGGAGAT
TACAACTCCCCTGAGGCTGGGCACAGTGGCCTGTAATCCCAGCACTTTGGGAGGCTAAGG
TGGATGGATCACCTGAGGTCAGGAGTTCAAGACCAGCCTGGCTGGCCGACATGGTGAAAC
CCCATCTCTACCAAAAATACAAAAATTAGCCTGGTGTGGTGGCGTGTACTTGTAATCCCA
GCTACTTTGGGGGCTGAGCCAGGAGAATCGCTTGAACCCTGGAGGCGGAGATTGTAGTGA
GTCGAGATCGTGCCACTGCACTCCAGCCTGGGCAACAGCGAGACTCCATCTCAAAAAAAA
AAAAAATTACAACCTCCTGAGAAGCTAATTAAGATTTGTAGTCCTCAATAATTTACAAAA
ACTTAGAAAAATTACCTCTAATTAGGTCTTAAGGGGCTTTTGTTAGGATGGACTTAAATT
TGTAAAGTCATTAATTGACTCTGTCATCAGAAATGCCTGTCCTGCTCTGCATCTGCAGTC
TCTAAGGTGTATGCGCCTTCTCCATTCCCCCAGGTTTTGAGAACAGAGTGCTGTTTTAGA
GCTGGCAGCAGCATCTCAGCCCAAGAGAAGGTAAGCCTTGAGCTGGCCAATGATCCCCCC
AACCCCATAGTGGAATGAATAAACAGCTGATCTTGTTAAAACTCGCTTCAAAAAAAAAAG
ATATCAAATGATGAAATCACCCAAAATAGCTGGAATTACCGGCAGATTGTGTAGTGGTGA
ACCTACGGTTTTCTGAAGATATCTCTTACCCTGTGATTGACTGTCAGTTGGTGCAGAAAG
TGAGATTGAAATGTAGTTTCTTTGCAGGTTATATTCCCAGAGGATGTCAGTCCCAAGGAC
CAGTAGCTGCCATCAGTTTGGATTCTGAAAACTAACCGGCATCAACACTGGGTGTAGAAA
CATGCTTGCCTTATGTATCAGAGGACATGCTCAGCAGATCCAAGAGATATATTTGGCAAC
TTTTTCTAGAAAAGGCACATTGGGTATCATTCATTACATTCTTGAGTTTTTTTGGTTTTT
TTTTTTTTTTTTTTTGAGACAGTCTTGCTGTATTGCCCAGGCTGGAGTGTGGTGGCACAA
TCACAGCTCATTGCATCCTCAATCACCCAGGCCTAAGCAATCCTCCCACCTTGTAGCTGG
GACTATAGCTCACAGCACACCTGGCTAAAATTTTTTTTTTGTTAAGACGGATTCTCTATG
TTGCCCAGGCTGGTCTCAGGCTCCTGGGCTCAGATGGTCCTCCTGCCTCAGCTTCCAAAG
GCACAGGCCAAGTTGTAGCTTTGTCCCTTGCCATCATGCCCAACAAGAGGTTCTATACCT
TTTAATGAATTGACTTTCATAAATTGGTTATGTTGGTGGGCAAGTTCTTTAAGCTGGAAA
TTGTAAATTCCTCCTGAAATGTTTTTTCATGCAGTTACCATGAACTAATACTACAATAAA
GGATGGTCTTGGGTGTCAATTCTTGAAAATGTGTATTTGAAGAAAAAGTAAATTTCGCCT
ACTGTTGTCAGATATTAGCAGTCCAGATATTCGCTCTAGCTTGTAAACTTCCCTGTGGTC
AGCCTAAGCTCTTAACCCCCTATTCTACAGCTTTAGACTGAAGGCAAAAGCTCAAAGCAT
TTAAGGCCTCCTCAATTTCGGCCCCTGCTGCTCTGTGCTCTGTTCCTTGGTGTAGCTTTG
TTCCAGCTCCTGCAGCATTGCACCATTCCTAACCACAACCTTAACAGCATGTAGGGTCCC
ATACTCTAGGCCCCATCTTGCTGTCTTCCTGTGTTGGAATCTTGCCTGTCAAGAGGGTCC
TCCCCCATACTGTTTGCCCACAAGGTTCAAGAGTGATTGGCTCCCAGTCTTCCTGGACTG
AACTACTTGGATCTAGGGGTTGCCTGTTATTTAGAAGAGATCCCTTAACTGGTAGGGCCC
TTTCAGTAGGAGAGTATTTGGGTAAGGGGAGGGTTTAAGATGAGAACCTTTGCTAAGTTA
GGCTCCTTTGGGAGCCTCCAGTTTGTTTCTCCCTCTCCCCAGCCATCTTGTTGGATCTGC
CAAGGGATTGGACTCCTTCATTGTCCTAGGTTTTTAAGGTTTTAAAGCCCACCTTCTGCA
GTCGGTTTTCTGGAATGTGTTGGTGGATTACTTAAGAGTTATGGGGAAAGAGTTCTTACA
GCCTGTCTAGGTCAGTGAAGTCATACTGGCAAGTGACAAGAAGGAAGCCAGGTTTGTCAC
TTACCCTGCATGCTAAGGACATCAGAGCCCACATAGAAGTCTGGTAGTTTTCCAGTCAGC
AGTGGGTAGGGAAGGTGGATAGGGGATTTCTGAACAGGACTTTATGCTTGTATGCATGGG
CACCATGTCTGTCCTGAGCACTACCACATGGCATCGTAGGCTGCTCTGTCAAAGGATATA
GCGACAGCTGGTCCTATGGGCAGATGCCTAGAATCAAGGTGGGCCTCAGAAATAGGGCTG
GGTCTCCAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1252, 1498..1541, 2024..2092, 2913..2969, 3207..3868
1001..1252, 1498..1541, 2024..2092, 2913..2916
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved