Pan_troglodytes Locus TCTP_PANTR
snOPY snoRNA Orthological Gene Database
Pan_troglodytes TCTP_PANTR
Pan_troglodytes
TCTP_PANTR
13_random
SNORA31
4577..4706
6286
AAAGTTCTGGGATTACAGGCATGAGCTACCATGCAGGACCTGTTTTGTTTTAATACTTA
GTAATTGGGTGTAAAGTCCTTCAAAAAACAGGTGGGGCAGGTGGGAAACTCCCTTTGTGT
GACCCTCTAGCACCAGGGATAAAATTTCAACTTCATCTTAAAGCGACAACATACTTTTCC
AAGACCAAGTGCGAAATAGTAAAGGGAAGAGCTAGCTCCGTAGCCGTCCGCCACAGAATG
CCACAAGCTTTCAATTATGGGACAAAATTGGAACACATGGAAACCCTGCGCAGACTCCCG
TGACATCTTCCCTCCTCTCCAAGTCCCTTCCCACAGACCCTGCGCCCCACACGATTATTC
CCCAGGGGCCGAGCAGGACGACTTGGGTCCCACTATCCGGACTCAGCGGTGCCCCCACAA
AAGCGTCCCAAAAACTCCAGCTGGGGCAGCCCTGGGGCAGATGCTGAAAAGTTGTCAGAG
GCCCTCGGGCAGTCCCGAGATCTACCCCAGGCCAGAGGGCCTGACCCTCCCTAAATGCGA
CGTTCTCCTACCTTGGTTGATACTCACTTTCCCAGAAAAGGGTGGAACCTAGGCTGGACG
AGGCGCAGGGCCAAAGTTTAATTCCTCTAAGCTCCACCCAGCTCCCAGCACCTCTCCAGG
CGGCCCCGTGGGGTAGGGCGGAGCCGGGTCCAACGTACTCCGCTTCCCCCGCTCCACCCA
CCCAGGGCTAGGGAGCGCCCCGAGAGTTGGCCTCCTCCCACGCTGCGCGCGCACCTCCCC
GCCCCCACCCCTACCCGCTGGCGTGCCCAGTGGAACGGAGCCTTCTGTCTCCGCCTCAAG
TCCCCGGATGCTCACCTCCCCGACTCGCCCCTGCTGTGGCCCCGCCCCCGCGCGGCTCTT
CGTGCCACGTCACCGCCTGCGTCGCTTCCGGAGGCGCAGCGGGCGATGACGTAGAGGGAC
GTGCCCTCTATATGAGGTTGGGGAGCGGCTGAGTCGGCCTTTTCCGCCCGCTCCCCCCTC
CCCCCGAGCGCTGCTCCGGCTGCACCGCGCTCGCTTCGAGTTTCAGGCTCGTGCTAAGCT
AGCGCCGTCGTCGTCTCCCTTCAGTCGCCATCATGATTATCTACCGGGACCTCATCAGCC
GTGAGTCCTCACTGCACTATCTTTACTGCCGCACACGGGGGTCTGGGGTGCGGGTGGGGG
CGGGGAAGGCGCAGCCGTCGCGGGCCTAGGGGACGCCGGCGGTCTTAGCCGAGCGCGGAG
GGGTCGGTGCCCGGGGCTCGCGCCCAGCTCTGGTGAGCTACGGAGGGGCAGATGCCGCGT
GCGGCCGCCGGCGCGGGAAATGCGGGAAATGGCGGCGCCGGGCGCACGGTGATGGGCGGC
TCTGTGTATCCGGCAGACGATGAGATGTTCTCCGACATCTACAAGATCCGGGAGATCGCG
GACGGGTTGTGCCTGGAGGTGGAGGGGAAGGTGAGTCGGTCAGGCCTGCGCGTGGGGGAG
TCCGGGCCGAGCAGGCTCGGGTTTCCGCCGCTCCCCCGCCTGAGGTTGTGCAATCCTCCC
CGCCGCCTCCTGGCGGAGGAGACGCTCTTTCCGGGCTTGGGTTTTTCTAGAAAACTGGAG
GCGGAGCTGATCCTGGAAATAGGCCCGCCGCCTCGGCGCCCATCCTCCTCCCGGGGTTGT
CCGGGACATGATGCTTCCGGCTTAGGAGCCCGGAGTCCTTTCGTGTTTGTCCTGTCCCCA
CTTAACAACCAGAGGCATCACATGTCCGCAACTGGAAACAACTTTTTAATGACCCCATTT
TTTGTTCCGGCCAACAGACAACTCTTTTAAGTTAGGTCGTTTTGAGAAATCCACGGGTCA
CAACTTTATTCCCAAAATGGTGCTTTTTTTATTTTCAGCAAGAACTAAGAATACTTCTTA
TCCGTGAACTATTGGCGTGGAAGGTGCTTTGGATGCGTTTGTGTCTTTTGCAATTATACT
GCTTTTTCTTAATGCAGATGGTCAGTAGGACAGAAGGTAACATTGATGACTCGCTCATTG
GTGGAAATGCCTCCGCTGAAGGCCCCGAGGGCGAAGGTACCGAAAGCACAGTAATCACTG
GTGTCGATATTGTCATGAACCATCACCTGCAGGAAACAAGTTTCACAAAAGAAGCCTACA
AGAAGTACATCAAAGATTACATGAAATCGTAAGTGATACTGGCAGTACCTAGCTGATGTC
TAGAATCTTACAGGATTTAAAGATTGGCTAACTTTTGAGGTTCTTTCGCAGTGGGTATAC
TTTTGTGAAAGTCCTTGCTTTTTTATTAATGAGTTCACGGAAAAGAGTGGTTGCTTTTCT
ATAATATGAGCATACTGAAGCCTGCAGTCTGTTTCCGTTTAGAATTAGAATAGTATTTTG
AAAATAGTCAACAAGAAATGTAAACATTCTTGAAAGATACCTTCTGTGAACTAGTAATTT
CTTAACAGCTGGTTGCCTTTTTCAGTGTTTTCTTTTTTTAAGCTTGGATATTTTTTACTT
TAAAAATTGATTTTACTGAAAATTCAATACTTCAACCTGTTAATGAAATGTTGTTTTAGA
ATCAAAGGGAAACTTGAAGAACAGAGACCAGAAAGAGTAAAACCTTTTATGACAGGGGCT
GCAGAACAAATCAAGCACATCCTTGCTAATTTCAAAAACTACCAGGTAAATACCTTAAGT
ATCTGGATCAAAGGATTGTACAATTTTAACTGCAAAAGCAAAAATTAAGTTGATTAATCT
TCAATTCTATACTAGTATTCCAGGTGTAGAAAGTGGCTTTCCCAGCTCGCAAGTGTTTCC
AAATCTTGTCTTCTGATTGAAAATTTGCTTCCCAGATGACATTTCTCAGTTTTTCTTTTT
GTGAATTGCTTAACCACCTAAGTGTTCTTTCAGTTTTTTGCTTACAATTCTAATGTGTCT
CATTGCTACTGGTCCTCCTTCTAATGTATCTGAGCTTGTTAATTCTACTTTTGGAAAATG
TCAGTGGCTTTCCCTTTCCTCTAATTTTCCAGCTTCATGCATCCCCTGGCCATAAGATAC
TTCCAGACTGTATGATAATATTCTATCACTGTCAGTCTTATGTTCCCTGTGGTTGACTAT
ATAAGCACGCTTTAGGGTTTGGGATTGTATTTAGGATTGAGAGTAAAGGTTTCCTGAAAG
CCTAGTGTTCCTGGATTGCTCTGTACATTATTTTTCTATTTAGGTCACTATTAAGGTGCC
TTAATCCAGTGAACAGATGTCTATGATAAGTGAGCATCAGAGCTTTTGGGTACTGGAGTT
TTGATTTTTGTGGTGGTCTAAACCTTCCCTTGTACTGTAGTTTGTTTTGAATGGCATGTA
TTTGTATGTAATAGTCTAATTCTAGGTATTTTGTTTGCTTCCCAAGTTCTTTATTGGTGA
AAACATGAATCCAGATGGCATGGTTGCTCTATTGGACTACCGTGAGGATGGTGTGACCCC
ATATATGATTTTCTTTAAGGATGGTTTAGAAATGGAAAAATGTGTAAGTACAAGGAAGTG
GGTTAAAATAAGTAATGTAAAAAAGATATTTTAGATGTGATTTGCAATTGTTTTGTGACA
CTGAGAATGAGTTTTACAGCGTTCTGAAACATGGTTTTAGTTTTCTCTTTGGGGATCAAG
AGAATTGTGTTTCATATGTAAAAGATTCTTAGGGTATAAAAAGGCTTAGAATCTTATTTG
TGGAAAACGTTGAGTACAGATGGGGCATAATAAAGTACAGTTTAGGCTGGGTATGATGGC
TCACACCTGTAATTTCAGCACTTGGGAGGCCGAGGTGGGTGCATCACCTGAGGTTGGGAG
TTCGAGACCAGCCTGGCCAACATGGCGAAACCCTATCTCTGCTAAAAATACAAAAATTAG
CCAGGCATGGCAGCGGGCACCTGTAATCCCAGCTAATCGAGAGCCTGAGGCAGGAAAATC
ACTTAAACCTGGGAGGGGGGTTGCAGTGAGCAGAGATCCCACCACTGCACTCTATCCTGG
GTGACAGAGTGAGGTGCTGTCTCAAAAAAATGCAGTAGAGTTTAAATGCTGAAGGAGATC
AGAGAACACCATTGATCTTCCTCTAGATATGGCCTCACTCTCACTTCATAATCATATTTT
GCTGTATACGTATGGATCAGTATCAGTGGTTTTCACTTTGGTTTACTGATAATGGGCAGC
TGATCATTGAAAAGCCTAGTGCAGTACTGGCTTAGTAAATAGAGCTGACTGCTGAACTGG
TATGCAAATTGTTTTACTAATAATAAATAACTCAGTGTCTTCTATGGAAGGAACTGCTGG
AAGCTGTACAGAAACAAAGGCATTCATTATCCTAGTTTTCATAGGCTTCTGTAAAAGGAA
GAAGATAAACATAAAGCTATACTGAACAAGCAAGATTAGAGTCAACAGTAGACAGAAATT
ACTTAGAACAGTATAAGATGACTTACCAAAGGGGTTATTCAGACAGTATCTGAGGTTTTT
GTTGGTAGAGCAGGGTGTGGGTGGTACATTCCACAGCCTTCTGAAAAATGAGCTACCGCT
GATTTGGTAAGGGTGTTCTGCATCCACTGATAGACCTTGAACAATTTACTGTTGTTCTTT
TGGTTTGCACTAGGATGCAAAAGAAAGAAATCCCTGCGCTTTCTGTCTGTCTTTGTGGCG
GCCCAGATTGAATTGGGGAATACATCTTTAGCCTAGAAATGTAGGCTGCATGTTAATGGT
AATGTAACTTGCAGTGTAATGTTTGAAAAATATTAATGTAGTTTTTGCTTTTACAGTAAC
AAATTTGGCAATTATTTTGGATCTATCACCTGTCATCATAACTGGCTTCTGCTTGTCATC
CACACAACACCAGGACTTAAGACAAATGGGACTGATGTCATCTTGAGCTCTTCATTTATT
TTGACTGTGATTTATTTGGAGTGGAGGCATTGTTTTTAAGAAAAACATGTCATGTAGGTT
GTCTAAAAATAAAATGCATTTAAACTCATTTGAGAGAATGCCTTTTAGTTTAATGCATAT
TTAAACTAAATTGATCCTGTAGTGTTCCTGGAGAAGCTAGAGCCTGATTGTAGGCTACTA
CTCATCAATTAACTTCTACAGTGGAGACTACTTCTGGGACTGGAATATAAAAAAGAATCA
AAGGTTCTGATTTTGAGTTGCAATAAAGGGAAAGACCATGCTCATAGCAGTGCCAACATC
TGAAGTGTGGAGCCTTACCCATTTCATCACCTACAACGGAAGTAGTTAACTGGAAGAGAT
TACCAAGAGAATAAAGAGAGACTCATTCAGTGGAAGCAACTTTGTCTCAGCTTATTTCAC
ATAAAGAGAGCGAAGTCTTTTGGGATGAATGTTAAACTCCCTGGTAACTAGAACAGGGAC
TGGCAAACTAGCCTATCCGACCACCTGTTTTGTACACTTTAAGGTGGTTGGTTGCCTTTT
TAAATGGTTGAGGGGAAAAGAATACCTTGTGGGATATGGAATTTAAGTTCGAGTCCGGTT
TTATTGGAACGTGGCTATGCTTATTCATTTATGGATTGACTGTGGCTGTTGTCAGTGCAT
GAGCAGAGTTGTGTCTAACAGACTAGAGCCTGCAAGTTTGCCAGCCCCTGATTTAAAAGA
TGAAGGTACACAGAATGTGGGCTGGCTGGTGGGCAAAGGGGTAAAAATGTTCTCTATATT
GTATCTGAAAAGATGGGGTGTCTGAATAAGAAAATGCATCTATTTGACAGACCTGGAGCA
GTTGCTATCTGCTGCTAAGGTTTCCACCACAGATGCAAGAAGAACATGTCCTTGCGCTTT
CCGTCTGTCTAATTGTGGCAGCTGAGATTGAATAGAGGAATACAGGAGGAAAAAAAGCGG
GAAGAGTTTTTGAGGCAGGTCGGTCACCCAGGCTTGTAGTGCAGTGGCACAAGCAACTCA
CTGCATTCTCTGCATCCTGTGCTCAAGCCATTTTCCCACCACCTCAGCCTCACTAGTTGC
TGGGACTGCAGGCATGCACCCCTATGCCCAGCTAATTTTTGTAGAGACCGAGTATCGCTT
AGTTGCTCAGGGTGGTCTCAACTCCTGGGCTCAAGGAGATCTGCCCACCTCAGCCTCCCA
AAGTGCAGGCCCAGCCTGGGAGGGGAATTTTCAAAACGTGAGTTTTGGGAAATAGTCTAC
CAGCCTTACCTGGTTGATTACACTTGTAAAAGAAAGATTAAAAGCAGGCCAGTGACTCTG
GTCTGCTTGAACATGTGAATGTAGTGGTTTGAGCAATCTGGAGTTTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1139, 1396..1469, 1997..2187, 2579..2684, 3406..3522, 4796..5286
1112..1139, 1396..1469, 1997..2187, 2579..2684, 3406..3522
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved