Pan_troglodytes Locus mono
snOPY snoRNA Orthological Gene Database
Pan_troglodytes mono
Pan_troglodytes
mono
1
SNORD64
1001..1067
2067
TTAATTTCCTGTGCTGAGCAAGATTAAACTTAAAAAAAAAAAACAGGTCCATCCTAAAT
GCCCAAGATTTAAGAAGGAACCTCATAGTTCAACTGGGTATTTGATGAATGTGAATGATT
TTGTATTTGATGAGCTGATGAGGACAGTATAGTGATGCAGAGGGTAGGTGCTTGTACATC
TGAATTGTTTGGGCTGTCTGTTTCTCATTTTGTATGTAATTTATTTGTATTTAAAGAGTT
CATTTTATGTTAGATTATTTGTGCTTTGGTAGCAAAAATATATTTGAAAGGGTAAGTTCC
TGAAATCAGCAGTTTCATGTCTGCTAGGAGACATGTATCAGGAAAAGTAGTGTGGGTTCT
ATTATTTCCATGCTACAACTTGGATGGTGTTACCTTACCACTTTGGTCCCTTGTTTCAGG
GATGTTAGAACTTAGCTTAGACCTTCCTCAGAATCCTTTTGGACTTTGTGTTTCATTTGT
TTGGCCTGCCTTGATTTTATTTGGTCATCCTTCTTGATTCTTTCATACTATTTGTTTACA
TTTAACTCTGGAATATTTTGGTGGTTGTTTTCAATGTACTGTAGGTCTTTAAATTGGTTT
ATAATGAATTATTGAGGAGAATAGCAAGTTGTTGACATTATATCTGTCTGTAGTAACATT
AGAATATTTCCATTTCAATTTGTTGGGCAATTTGCTTGTGGAAATATAAGATGTTATATT
TACTTCTATCAAAACCAGGATCTCAATATTATTCTTTTGGCAGGTTGCTGCGCGCGCGCA
CGCGTGTGAGTGTGTGTGTGTGTGTGTCTGTCTTTGATTTTTTTCCTTCATATTTTCCCC
TTAATTCTGTGTCAGTCAATACTGTTGCTGTTTCACATCCATTGTCACATAAAACTAGTC
ATCTCATTCTCCCAGGCCCCCTGTCCTTGGGAAGGGATGTGCACTCTGCAGGTATTAGTG
ATTTTATATAGCTGCATGAGTTGCTGGGAAAGGCCTTGGCTGGATTTATAATGAGCTGTG
TTTACTGAGCATTATGAAGTAAAGTTCAATATGATTACTCTGAAGTCTGACCTAAAAAAA
ATCCTACTCCTTCACTATACAGATAGGGAAACTGAGGCCTCTCAGGCTGGACTTTAAATC
CCCAATCCTACTTTTCCATTTTATTCTAGAAGGTCAGATGAGAGGAAACACGGCTCTGTC
ATGGATGACCTCTAAATGATCCCTGACCATTCTTAGCATCCTTCTTTCTCTTCCCCTCAT
TGACCTAATCCTGACTTCTTTTATCTCTTTCAGATGTATGCCTTCTTTCTTAATAGCCAG
GAAGTGTTTCAGAGTCATACTCTCTGGTGTAGAAAGACCTTCAAGGCCAACTAACCCACG
TCCCACTTTTGGTGGGAGGGGGATTGGCATTTATTGAGCACCTATTAAGTGTTAAGTGCT
TTTTGATTTTTTGTCTTATTTATTCCTTACTTTAGTCCTATGAGGTTGTGTATTATCCCC
ATTATACAGATGAATAAACTGAGGCTCAGAGGGATTAGGTATCTTGACCAAGGCAACAAA
GATAATAAAGATAATTCAGGATTTGATCTAGGCATGTTTGATTCCAGGACAGCAGGCTGT
TTCTCTGGCATTTGAATTCCTTCTATAGCATTCCTGACAAAGGGTATGTAACGTCTTCTT
GACAACCTCCAATGGCAGCTCACTACCTTCCAAGGCAGGCCACTTGGCCTCTGACTGTCA
ATATTCAACAGAACATTTCTCTGAACCCGGTTTTTGTTCCCATATAGCTTTTATCCCTTG
ATCCAAGTTCTACTCTTAGGGACCCCAGAGCATTGTATTTCTAATTCACCTGCCTCTAGT
GGACAAAGTGGTTGCACTCCATACAGGATGGCTGCAACAGGGACACAACTGGACACTTGT
CTGGTCTAGTTGGTAGGAGGTGTTCAGAAGAGCACAGTACTTCAAGGTAACTTTGTTCTA
CTTTCCTTTCCCCAGCTGCCTGCTTGTTGAGAGCCCAGCCTCTTTCTTCTCTCTTTGTCT
CTTTTCTCTTGAGGAGAAGCTAGTCTTC
  Untranslated Region
  Coding Sequence
  snoRNA
NC_006468
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved