Pan_troglodytes Locus SNHG3
snOPY snoRNA Orthological Gene Database
Pan_troglodytes SNHG3
Pan_troglodytes
SNHG3
1
SNORA73, SNORA73
2362..2566, 3544..3744
5293
CGGTGGCGGGCGCCTGTAATCCCAGCTACTGGGGAGGCCGAGGCAGGAGAATCGCTTGA
ACCCGGGAGGCGGGGGTTGCAGTGAGCCGAGACCACGCCATTCCACTCTAGCCTGGGTGA
CAGAGCAAAACTCCATCTCGAAAAAAAAAGAAAGAGTATAGGGCAGTGCTTTTAATTACA
TTCATTCACACTGTTGTGCAATGGAGTTTTTTATTTTTTATTTTTATTTATTTTTATCCG
CGCCAGGCCTGGAGTTTTTAAACTTTTATCTGATTCGTCTAGGGGCACTTTCATCTTATT
TACCTTCACATTTATCAAATTATTTCTTTCACAGGTGACAGAGCAGATTCAATTCCTTTT
GATACTCCGTATTTCTCTATATGTATTTTTTTCCATTCTGCATTCTTATTATTCCAACGT
TTTACTTATTTATTTATTTGGAGAGAGAGTTTCGCTCTGTCGACCAGGATGGAATGCATC
GGCGCGATCTCGGCTCACTGCAACCACCGCCTCCCAGGTTCAAACGATTCTCATGCTTCA
GCCTCCCGAGTAGCTGGGACTGGAGGTGCGCGGCACCATGCCCGGCTTATGTTTTGTATT
TTTTGTAGAGACGGGGTTTCGCCATGATGCCCAGGCCGGTCTCGAACTCCTGGCCTCGAG
CGATCCGCCCCTCACGGCCTTCAGAGCTGCTGTAATCACAGGCGTGAGCCACCGCGTTCG
ACTCTTCCAAAAACTTTTTGGCCAGTTTATCTAAGGGCATATCCTACAGACTGAGTCCAG
TGATTGCACAGAAGTACACGTCCTCTGCAGCTACATACCTACAAACCTATTTCTGTAACG
TACATTCCCCAGCAAGGTCCCGCGGGAAGGATCCACTACCGCGAGAGGCCTCCCAGCCAG
GAAGGGGTGGGGCTCAATCTGCAGTAGATTCCCAGAAGCCTCAGTGAGTTTCTGATTCTC
TAACTGCGCATGCTTCTGCGCACGCGCAATAGACATTCCAGGACTTCCGGGCACTTCGTA
AGGTTTAAATAAGGATGCTTCGCGTTCGCTCTCCCTCTTGGAGACAGATTCGCAGTGGTC
GCTTCTTCTCCTTGGTAAGTGTGATCAGATGCTTGCCACCGGAGTTATGGGTCTAATGCT
ATAGATCAGTAGCCGAGCTTCCCTAGGAGGATCATATAGTATTTTATTTACTTACTTTTT
TTTTTTTTTTTGAGACGGAGTCGGTTTGTCACGCAGGCTGGACTGCAGTGCTCGTTGCAA
CCTCCGCCTGCCGGGTTCTAGCGATTCTCGTGCCTCAGCCTCTCCAGCAGCTGGAATTAC
AGGCACGTGCCACCACGCCCGGCCAATTTTTGTATTCTTAGTGGAGACGGGGTTTCGCTA
TGTTGGTCAGGCTGGTTTTGAACTCCTGATCTCCGGTGATCCACCACCCTCGGCCTTCCA
AAGTGCTGGGATTACAGGCGTGAGACACCCCGCCTGGCCGGAAATCATGTAATTTAAAAC
TATATATGGGTGTCTTAGGCGGCATCCGTCCCAACTCTAAAGTACGCGTTAGACGGTCCT
GGGCCAGAAGTGGGCCATGGAGACCTCGGGACCCGCAGGGCTGCCGCCCGACCCGGCGAC
CCTCTGAAGGTGCACCGCCACCCCCATTGTTTATCTTACTGCCTCATAGTAGGCACATTG
TCGTTCTCAATAGAATTGCACAGTTTTATTCTGGATCCCCATTTGCCTTTAAGAATTTTC
TCAATTTTTCTTTTTCTTTATTTGATCGTACCACTGCAACCTCCGCCTGCTGGGCTCCAG
CATTTCTCCTGCCGCAGCCTCCCGAGTAGCTGGCACTACAGGCGTGTACCACCACGCCTG
GCTTATTTTTGTATTTTTAGTAGAGACGGGATTTCACCATGTTGGCCAGGCTGGTCTCCA
ACTCCTGACCTTGTGGTCCGCCACGCCAGGCCGAAGATTTTCATAATTTGGAAGCATTAC
GTTTCGTAATTATGCTTTCTCGTATTTTTGTGATTTGGGTCATTTTTATTTTTATATTTT
TAGGATTACAGGCGTGAGCCATCGTGCCTCGCCGATTTGGGGGTAATTAACAAGTCCACG
TGTTTCATGTGAATTTAGGATAGCTGGGCCTAATTGTTGTCTTTGCTTCTGCGGTACCTT
CCGCATCGTACTAACCGCCTATTGTAAAGTAATTAGAATAGCTGAATATGCATGTTACCA
GTCTAGAAACCGATTTTTTTTTAACACCCCACTGTGGACAGGGTGGAAACTCGTTTGCTT
TCTTGTTTAAGATCTGTAGTAACATGAATGGATGAAATTGTTTCCTATTAGATTCTGTAA
ATTTATGCGTTACACTGATTGTCCAACGTGGATACACCCGGGAGGTCACTCTCCCCGGGC
TCTGTCCAAGTGGCGTAGGGGAGCATAGGGCTCTGCCCCATGATGTACAGTCCCTTTCCA
CAACGTTGAAGATGAAGCTGGGCCTCGTGTCTGCGCCTGCATATTCCTACAGCTTCCCAG
AGTCCTGTGGACAATTACTGGGGAGACAAACCATGCAGGAAACAGCTCTTCTAGAGCACT
GAATCTGGATTGAAGTCTTTTTTTTTTTTTTTTTTTTTTTTGGAGATGGAGTCGCTCTGT
TGCCCAGGCTGGAGTGCAGTGGCGCACTCCATTGCCTCTGCCTCCCGGGTTCAAGTGATT
ATGCTAAGTGATTCTCCTGCCTCGGCCTCCTGAGTAGCTGGGATTACAGGCCCCCGCCAC
CACGCCCGGCTAATTTTTGTATTTTTAGTAAAGACAGGGTTTCACCATGTTGGTCAGGCT
GGTCTCAAACTCCTGACCTCGTGATCCGCCAGCCTCTGGCCTCCCAAAATGCTGGGATTA
CAGGCGTGAGCCACCACACCTGGCTGGATTGAAGTCTTAATACATGTTTAAGAAAAATTG
GCTAAAAAGTAGCCAGGCATGATGATAGGTAGCTGGAGGAAGGAGAATCGCTGGAGCCCA
GGAGTGACCTATGATTGTGCCACTGTACTCCAACCCCAGACGATAGCATGAGGCCCCTCG
TTGAAAAAGTTTAGGGTTTTGCTGTACTAATAGATTAATATATTGTTTTGCAGGATTTGT
TAAGGATTCCAAGTAACTCTTATTTGGTAAGTAAATCTGCTAATTGTTTTTTGCTTATCA
GCTCTTTGTCAATGATTTCTGTAATGGAAATAGGATTGAAGAGACTTTTATTCTAGTTGG
TCAGGATTTACCTCTGAGGCATTTAATCATTCTCAGAGCAATAGCCAAATATCGACTTTG
CTGCATTTTTGTAGGCATGTTGACATAACTTCAACATATGCTCTGTTCTGTAAAAATTGC
TTTTTTTAGTCAGCTCATTAAAAGTGCAAAGTAGTAAAAGTTGCCCTAGTGAACTGTAGG
AAGCCTAATTGGCTTTATCTACATGTGTAGCCTGAGCTGAGAAAGATACTAGCCCTTGAA
AATACTGTGGGTGATTAGCAATATTGGATTTGTCAGTTACTCCAATTCCTCACTAATGAG
CATTCCAACGTGGATACCCTGGGAGGTCACTCTCCCCAGGCTCTGTCCAAGTGGCATAGG
GGAGCTTAGGGCTCTGCCCCATGATGTACAGTCCCTTTCCACAACGTTGAAGATGAAGCT
GGGCCTCGTGTCTGCGCCTGCATATTCCTACAGCTTCCCAGAGTCCTGTGGACAATGACT
GGGGAGACAAACCATGCAGGAAACATATCTAGTATACTAGATTTTAAGTTGAAGTAGGAT
CTTCAGGAGTCTAATCATTATTTCTTTTCTTTTAGGAGAGAAGACGATCTGCACTTCGCA
TTTTGACATTGACATTTAATTTTAGGGTCCTTTATATAGAAGGGAGAGTAGGTAAACTGA
TTTTTTTTAACAGGGAGGGTTTGACAATCTTTGGCAGACTTGGAGCAAAAGATTGAGGTG
CATTTCATGCCTCCTTTTGAGAGTCTTGCTGTGTCGCCCAGGCTGTAGTGCAGTGGCGCG
ATCTTGGCTGCAAACTCAGCCTCCCAAGTAGCTGGGATTACAAACGTAAGCCACCACGCC
CAGCCCTCATACCTCTTTTAAAAGTCGACCTGTTTTGCAGAAAGTCTGCTGTTTTGTACT
AAAGGCTTTGGAATTTGGCATTTAGCTAGGAATGCACATTCTTACACCTCATTCATACTT
TAAGAACCACAGAAGTGACTCTGCTTGGCCAGAAGGCACTTCCGCCTCCCAGGTTCAGGC
GATTCTCCTGCCTCAGCCTCCCAAGTAGCTGCGACTACAGGCGTGTAGCACCGCACCTGG
CTAATTTTTGTATTTTTAGTAGAGATGAGGTTTCACCATATTGGCCAGGCTGTTCTCAAC
TCCTGACCTCGTGATCCGCCCGCCTCAGCCTCCTAAAGTGCTGGGATTACAGCCGTGAGC
CACCCTGCCCGGCCAATTTTGTATGATTTCTAATGTATTTGTAATTTACCTAACAAATTG
CCTAATCTGCTATGTTAATGTATTTATGAATTAAAATAAATATGACTGCATGTTTCTGGT
TCATTTTTGTGGAGGTGGCTGTGGTGACATCAGCCAAGAATCTGAATGGTACTGTTGAAG
GAAACTAGCATGATAGCTTCAGTTCTAAAGGCCCTGAAACCTAGTCTCAGGTGGGTCCCC
CTTGGGTTCACTTTATATTGGCAGTTTATTGGGAAAATGGGTATTAGGTCCTGACCAATA
GGACCGTAAGTCTGGGTTGAGTGCAAGATGAGTTAGACCGATTCTTTAGCTTCCTGCAAT
GTAGTGGAGGAAAAATCGATGGTAGCAATGGGAGGTTGTATCCCTAGCTGATGAGTTGTA
TGATCCTCTACTACCTGGTGCACCTCCGCCTGAAGATTGCCAGAATTGCTTGCCTCATGA
CGTGAGTCATAATGGAAACTTTGTCAAGCCCCCTGCACTGGCTGCCAACATAAATGTTCA
GTACCCTGAAGGGGGATCATCTAGAAGGTAAAGTGACCTACTGGCATAGGGGAAGTGGGA
CAGCCGTTAAGCCATTTGGAACTTGATGGGGACAGGTTTGAGAGAGGTGGGTGAGATTGG
AGTTTGGTGGACTGTAGAGCTTGCTTGTCAAGGTGTTGAGGGCAGGGTTGGTTGGAGAAT
GGAAGCTAGTTACTAGCTATGATTGTGGGGGAACACAGCTTGATTTTTCTTACAAGCTAA
GAGGAGTGAGGCAGTGTTTAAGAGGGCATCTTAAATGCAGCCAGACTTGGTGGCTCACGC
CCGTAATCCCACCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1093, 3113..3145, 3815..4293
NC_006468
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved