Pan_troglodytes Locus TRO
snOPY snoRNA Orthological Gene Database
Pan_troglodytes TRO
Pan_troglodytes
TRO
X
SNORA11
10083..10211
14916
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNATTTTCTGTCTGGATGATCTGTGAATTGTTGAAGATGG
GGTCTTGAAGTCTCCTACCATTATTGTATTGCAGTCTACTTCTCCCTTCAGATCTATTAA
TATTTGTTTTATATATTTAGGTGCTTCTATGTTGGGTGCATATATTAAATATGTTTATAA
TTATTTGATATTCACAATGAATTTATCTCATTATCATTATATAATGACCTTTAAGATCTT
TTATGGTTTTTGACTTTAAGTCTATTTTATTTGACATATGTATAGTTGTCCTTGCTCTCT
TTTGAATGATTGATGGAATAGATAAATGCCACGAATTGTTTTCTGCATGGGGGCACAGTG
CACCATGTCACAAGAGACAGTCTAAGTACAAACTGATATTGTTAAAACATCAATATAGTC
ATTGTGGGATCAATAAAAACTTTTCATAGATTTTTATACATTACTGTTTTTATTCTGAAT
TGCATAAGATGGACGGGCACCCTATCTTTTAGTGTTTAGAACCTCTAAATGTTTTAATGT
GGTAACACTTGAAAAACAGAAATGAATATGATCTAGTCCCCTGCTCCAGAGCAGCTCTAG
GGAAGAGAGACATAGACACAAGGTATAACAACACTATGTAAATAGTGTTGAGATAGAGGG
TCTGTAGGAAGGGTTAGTGTGGGAGTTCAGAGAACTACATTCCTCCTAGGGGAAACAGGA
GAATCAAATAGGAACGGAGATACAGAGTGGGGAATAGAGAAGTCAAATGGAGAATAAGAG
GGAGTGATAACTGAATAGGGGTAGTAAGCAGAAAAAGGGAGCTACATTGAGGAGAATGGA
AAGTTGAAAGTAGGTATGGAGGGGAGGAGACTGACAGGCAGGAACGGAGACCCCCCTCTG
GAGGCGGAAAGAGGCAGGACCACTTCCGGCCAGGGAGGGGGATAGGCTCAGACACAAGGA
GAGGCTTGGAGAGAGCAGACGCCTTCTGGATTCAAGAAGACGAGGTGAGCTGAGGTGCCT
GGCTTTAGTGAAGACCCTGTGGGGGCTTCCTGGCTGCGGCTTCGACGTGCCTGACTCCAC
ACGCCCCTAAGGTTTGAAGAAAACTTGCTGGAGGTTTGGGACCTAACCGCATCAAAGTCG
CCTTTAGCGGTGCCTGGACCCAGTTCGCACGGGAGAAAGTAGGAGGCAGAATCCCCTTTG
GGCCACAGAAAGGAACGATCTGGACTCGGTTCGGGCCGTGAAAGGGAGGGATGCAGACCT
AGTTGGGACCGCAGAAAGGAAGGAAAAAGTTTTCCTTCGGNCGGTGGGGGGGAGGGNGGN
GGNTNCNCCCNGTTCGGGNGGGNGNTGGGNGGCGGCNGGTTTCCGTTTNGGCTGGNGNNN
GGGGGCCGTTCCCTGTTTGGGCCNCNGNNTGGTGGGATCGGGGCCCNGNGNTNGGNGTGG
GCNGCTTCCCTTTTGNGCNNCGCCNCGCCCCNNNCTCNNNCNNNNNNNNGGNGGNGNTCG
TTAAAAATTNNTTCCNNTTTNNNNNNNNNNNNNCCNNNCCTNNTNNNNTTTNNNNNCNNN
NNTNCCCCCTTTTTAAAGGCAGTTGGATTTGGGGGTGAGGAATTCATGGTGCCGTAAAGG
GGGAGCTGCACACTTGCAGACGTGGAAAGAGGGGGGAGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACCAGATGGCCTGCTTTTTTA
GTATGAAAACCCAGGAGTGAAAGGATAGGGCCCAAGGGTTACATGAGACTCCCCTAAGTC
AGGATAGGTGAGATGTCTGATGAATCTCCCCCTCCCTCTCATTCTCTAACTCAGGCCCAT
TCCCCTCAGGCTCACCTGTTACTCGGCCTCCCAGAAAGATGGATAGGAGAAATGACTACG
GATATAGGGTGCCTCTATTTCAGGTGAGGCCTCTCTGCATTCTCTCTAGGCCATCTGCCC
CGTCCTGAGTTCACTTACTGCTCTTCAGACCCCTTCCACCGTGTAGTTTCATAATTCCCT
GCCTAACTCGTCTCAGTCCTCCCTTACATGGTGAAGGGGAGGAGAGGAAAACCTGCCTGA
CTCTATTCCTTCCTTGCTCCCTACCCCATTTTAATTAACCACTGCTCAGAGGAAGGGAAG
GCCTTTGTGGAAAGGGATGGGCTTTAGCGAGGCCAAATGGCCCAGAGGATGGTAATCCTA
AGTGTGTAGGGCCCTCTGCCTCCCCCGGGGAGCCTGGGGCTTCCCTTCCCTCCAGATATA
CAGACTGAGACCACAGAAGAGGACAGTGTCCTGCTGATGCATACCCTGTTGGCGGCAACC
AAGGACTCCCTGGCCATGGACCCACCAGTTGTCAACCGGCCTAAGAAAAGCAAGACCAAG
AAGGCCCCTATAAAGACTATTACTAAGGCTGCACCTGCTGCCCCTCCAGTCCCAACTGCC
AATGAGATTGCCACCAACAAGCCCAAAATAACTTGGCAGGCTTTAAACCTGCCAGTCATT
ACCCAGATCAGCCAGGCTTTACCTACACTGAGGTAACCAATACTCAGGCTTCTTCAGTCA
CTGCTCAGCCTAAGAAAGCCAACAAGATGAAGAGAGTTACTGCCAAGGCAGCCCAAGGCT
CCCCAATCCCAACTGGCCATGAGGGTGGCACTATACAGCTGAAGTCACCCTTGCAGGTCC
TAAAGCTACCAGTCATCTCACAGAATATTCACGCTTCAATTGTCAATGAGTCAGTCAGTT
TCCAAGCCTTGATAATCTCTATCAAGTCTAAGAAAGCTTCCAAGGCTAAGAAGGCTGCAA
ATAAGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG
ATTCCTGTGGAGATGCTGAGAAAAGGTGATATAGTTTCTGCTCCCTAGTTGTTCACAGAT
TGGTGAGGAAATAAGACATCCATACACTCAGCTACAACCTGTATGTAATACTACTTGTAT
TTAAATAGTAGTTACCACGTGCCAGGCTTTGTGTTGGGTACAGTTACACAGGGTATGTCT
GAATGTCTTGAAAGTAACTCTTACCAACAAGGGATCATAGGTCCCAGTTTTACACTTAAG
AAAACTGAGTCTCAGAGAAATGAAGTGACTTGTCCAAGAGGTACCAGCCAGCATAATTGG
TGGTAGCCAGAGGAAGAGAAAGACCCTTAGGCTCTTATCTTGAGTTGTTCCTGGCCTGGC
AGAGGAATGAAACTCCTTCCTGGAAGACAGTGAAAGATAAGCTCAGGACTCAGGGTGGCC
AATGGCAAGGTCAGGATCAGGCTCCACTACAGCAAGGCTGAGGGAGGGGGTTAGAGGGAC
TTTCTGTCTGGAGCAGGCAAGGTGAGGAGACAGAGCCATCTCTTTCACCTGGTGACTCTG
GACCTTCCTTCTCTCTGATGATGAAGTCCAAGCATCTGAATGGGGATGAGAGAAGTGGCA
GTAATTACAGGCGGATCCCATGGGGCCGGAGGCCTGCACCACCGCGAGATGTGGCCATTT
TACAAGAAAGGGTAAGAATCCAATGCTGTCCAGTCTCTTCTCTTCTTCACTTGCCCTCTT
CTCTGCCTCCCTTCCAGTTTTCTGNCAGCATGTTAAGATCTCTCCATCTATTCCTCTCCT
CCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCATGTTAAGATCTCTCC
ATCTATTCCTCTCCTCCCAGGCTAATAAGTTGGTGAAATACCTGTTGGTTAAGGACCAGA
CAAAGATCCCCATCAAACGCTCAGGTAGTGTCCTACCAACCCTCCTCCTTGAGCTCTCCT
CTCCACTCCCCTCTCCTCCCATAGTCTGGGAGTAACACTTTATGGCCTCTTTGTTCTGTC
ATATCTCCACACCTGCCCTCCTTGCACTCTGCCATGGCTGGCATCTCCCATTAACTCACT
TCAGGTCTCTGATTGCACTGACCCAACAGGACTGGCAAAAGGGCTGCAGCTCTGTGGCCC
CTGCTAAGCTCAGCTACTCTCACCTCTCCTTTTCTACAGACATGTTGAGGGATGTCATCC
AAGAATATGATGAATATTTCCCAGAAATCATTGAACGAGCAAGCTACACTCTGGAGAAGG
TGAAGGGGCAGTGCTGGCGGATGGGCGCAATGGGGAAGCTTTGAATCGAGCAAAGACATA
CATGTCCCTTTTGGAGAGAATCACAGAGACATGCTAATCCAGCCCCATTACTGTGTGAAT
GGGCAGACAGTGGCCTAGGGAGAGGTGTAGATTTGCCATGGGTCACACAGCATGTCAGTG
ATGAAAGCATGGCTAGGACAGAAGCCACTCAAATTAGTCTCAGCTTCTATTCATAGTTGG
ATACATTCTGCATGTATTTCAGATCTCACCTCTCCCTTGTATCCCCATTTTCTGTCTCCC
TAGATTCCTGCTCATCACAAAGATGATGTTGATGACAATAGTACATTTGCTGTGTGTTTA
CTGGGTGCCAGGCACTTGGCTATGTGCTTTATGTGCATTATCTCACTGATTTCTTACACA
TGCAAACCCCCTAAGTACACTGGGAGTTTTAGGATGCCCGGAAAGTTCACTGATACCTAA
GCTGAATTTTGTGATCTCACAGGCTATTCTTTTACTTGGCAGATGTTTCGAGTCAATCTG
AAAGAAATTGATAAGCAAAGTAGCTTGTATATTCTCATCAGCACTCAGGAATCCTCTGCA
GGCATACTGGGAACGTAAGCTGGGAAAGGGCTGGAGTGGGAAGGAAGCTTCTGCTTTTAT
CTGTGCTGCTACCCCTTCTTTGTCCTACTTCCCCCATCCTCTTACAGAGTCAGGAAAAAC
AGGGTCTCAAAAGCCCTGTCTCAGCACCTGCACATAGTTGGAGCCCTGCTCACAGTAGTG
GCACCTGATTATGATTGACTGAAGGGTATAGGAGCCTAGGGTGGGACATTCCTGCTGTCA
GGTTTGCTGTCTCTGTAGAAGCTTCCCAGGAAAGCAGGCCTGTCATTGCTTGCCTCTTCC
GATGGAGTGCCTGGCCTGGCTTTGACAGAGTGGTTCTCAAGGAGGGCTTCCTGGTGTGGC
TGGATCAGGATGCATGAAGCGCAAGAGTGTCAGTGGGGCTGAAGGTTCTGGGAGAGAAAG
AAGGGACTCACATTGACTGAGTGCTTGTGTTGTACCAGGTTGACAGCCATTCTTCCATCT
TCTTGGCAACCTGAGGAAGGGAGAATATGATTTTCCCATTTTACTGAATAATAGACCAAG
GCTTGCAAGGTCTAAGTGCCTTGCCCAGGGTGGCATAGAGCTGGAAGCAGAGACTGGGCA
GAATTCTGTATCTGAGGAATCTGGGAGAGGTTAGCCTGGTGAGCTGGCTGGTGTATCTTT
TGCGGATGGCTGCTGAAACATAAACCTTCTTTCTGTCCTGTTGAAACATAAACCTTCTTT
CTGTCCTGTTATTCCCTTAGGACCAAGGACACACCCAAGCTGGGTCTCCTCATGGTGATT
CTGAGTGTCATTTTTATGAATGGCAACAAGGCCAGTGAGGGTGAGTGGCTGGGCATGCAG
CTGAATGGGCGGCCATGGTCTGGATTCCATGTGTTCAATTTCTGTCCCTGTCTCCTCTTG
CCTCCCCTCACAGCTGTCATCTGGGAGGTGCTGCGCAAGTTGGGGCTGCGCCCTGGGTAT
GACTGGGCTCTCTCAGCGCTTGCTGTCCGTGTTGTCCTTTGGCAAGAGAGGATGGTCCTA
GGATTGCATCAGTCTGGTGGTCTGGTGGAGCGGGTGGGGTGCTGGACTGGGTAGAGGGCC
CAGGGTTCTGACCTGGGTGGATGACGGGCAAATGGTCCTGAACTCTCTGCTGTCTCTCTC
CTTTATGTCCTCTGTCTGTTCTAAGCTGAGATGTTAGATAGACCTTCAGGGATCCCTGAC
AAAGAGGCATCTGGTCTTAACTGCTTGCTTCTAGTGGCCATGTGCTCATTACTTTCTTCA
CTTCATTGAGACTGCCCCATGTGCTAGAGAGGTCTCTTCCATGTTGGGAAATGCCTCTGC
CCTCATCTGGGCAGTTCTGATCTGTGTTCATGGGTTATTTTTCCCATTGTCAGGGTGAGG
CATTCACTCTTTGGGGAAGTGAGGAAGCTCATCACAGACGAGTTTGTGAAGCAGAAGTAA
GTGGTGTCTGGCCCTGAAGTGTTCTGGGTATACTGATCTGGTTCAGAAAGTGCTTAGTCA
GTGCCTTTCTTATACTAGCTTTAGAGGGATGGGCATCCTGTATCCTAGAACTGATACTGT
CTAAAATTCCCATGGGCAGACCTTTCCAGGACTGGGCCAGACTCAACACAAGGCCCTTGC
AGTGGGGTGCGCTCAGAGCAGAGGGCCTTAAGAATGGCTCCTCTGTTTACAACACACCCA
ACAGGAATCTGGGCTTACTCCTCACAGGTGGCATGATACTTTGGCCTTCCTGTGACATCA
TGCCCTATACATGTCTCCCCTGGAGAAGCCCAAGGGACTGCTTTGCACAGGGCCAGTGGG
AAATGGCTCAGTATTGGAGGCCAAGACCATAAACTGTGTTTGGTAGTGAGTCTGGGGCTG
GAGGGTCTTAGAAATCCTTCTCCAGGGGCTGTTTGCATTTGTTTGGAGGAGGTTGCCACC
TGGTGTCTAGTGCTTAGACAGCAGGGTTGCTTGGTTAGAAACAAGTTTCATTTCCTTTTT
CCAAGGTACCTGGAGTACAAGAGGGTCCCTAACAGCAGACCACCTGAATATGAGTTCTTC
TGGGGCTTGCGCTCCTACCACGAGACTAGCAAGATGAAAGTCCTCAAGTTTGCATGCAAG
GTAAGAGGAGAGCTGCCCGAGCTTGGCATATTAAGGCAATGGGATACCCTTGGCTGGGGC
AGGCAATGCACAGGGATGGGCAGGTACAGAGCAGCCTGCAGCTCATATATAAACATGTGG
AGCCTCCTTTATGTCCCAGGGTGCTGCTAGATATATAGTTTACATCATCTCATTCATTCT
TCATACTTTGTATTAATCAGCATGGGCTGCCATAACAAAATACCATAGACTGGGTGGATT
AAAAAACAAATTTATTTTCTCATAGTTCTTGAGGGCGAGAATCCTAGGTCAGGGTCCACC
AGGGTCAGTTCCTGGTGAAGGCTCTCTTCCTGGCTTGCAGATGGCTGCCTTCTTGCTGTG
TCCTCACATGGCTTTGTGTGTGAGAGAGAAGAGAGCAAGCTTTCTGGTGTCTCTTCTTAT
AAGGACACTAATCCTGTTGATCAGGACCCCACCCTTATGGCCTCATTTAACCTTAATTAT
CTCCATAAAGGCCCTATCTCCAAGTGCAATCACACTGGGTGTTAGGGATTCAACATACGA
ATTTGGGGGCGGGCACAACCCTTCAGTTCATAACATATTTACGCTCTATCATTTCCCGTA
ATTATAAAGACACTTAGGCTAAGTGAGGTTAAGTAACTTGTCCAAGGTCATATAGCACGT
AAGTCATCAGAGCTGAAACTGGAGTTCAGAACTGACCCATGATAGAGCCCCAATAACTGA
GAATTTTAAAAAAGTATTGCTACTAGTTTAATACAAAGCCCGTAGGTTAATACATGATTA
CTAGGGTTGTTTTCTTATTATGATTATCATCCCCATTTCAGGTGCAGAAGAAAGACCCCA
AGGACTGGGCTGTGCAGTACCGCGAGGCAGTGGAGATGGAAGTCCAAGCTGCAGCTGTGG
CTGTGGCTGAGGCTGAAGCCAGGGCTGAGGCAAGAGCCCAAATGGGGATTGGAGAGGAAG
CTGTGGCTGGGCCCTGGAATTGGGATGACATGGATATCGACTGCCTAACAAGGGAAGAGT
TAGGCGATGATGCTCAGGCCTGGAGCAGATTTTCATTTGAAATTGAGGCCAGAGCCCAAG
AAAATGCAGATGCCAGCACCAACGTCAACTTCAGCAGAGGAGCTAGTACCAGGGCTGGCT
TCAGCGATGGTGCTAATATTAGCTTCAATGGTGCACCCAGCTCCAGTGGTGGCTTCAGTG
GTGGACCTGGCATTACCTTTGGTGTTGCACCCAGCACCAGTGCCAGCTTCAGCAATACAG
CCAGCATTAGCTTTGGTGGTACACTGAGCACTAGCTCCAGCTTCAGCAGCGCAGCCAGCA
TTAGCTTTGGTGGTGCACCCAGCACCAGCACTAGTTTCAGCAGTGAAGCCAGCATTAGCT
TTGGTGGCATGCCTTGTACCAGTGCCAGCTTTAGTGGTGGAGTCAGCTCTAGTTTTAGTG
GTCCACTCAGCACCAGTGCCACTTTCAGTGGTGGAACCAGCTCTGGCTTTGGAGGCACAC
TCAGCACCACGGCTGGCTTTAGTGGTGTACTCAGCACTAGCACCAGCTTGGCAGTGCACC
CACAACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNGAAGGCCCGCCCCAAGTCTTGGGTGCCTGTGGCTTCTCCTA
TGGGCTAGTGAGGTTTCAGGTAACTGCAATATTTCCATAGCCAGGACCCACAGGGATGGG
TATAAGAGCTGGGAGATGTTGTAAGAAACACTAAGGCAGGACAGCAGGGTGGAAAGGTGA
GGGCAATTAAGGAATTATGAGAAGACAGTGTATTTGGTGCTAAAATGTGTTCCTATTTGT
TTTGTTTTCAGATTTATTCCCCATGTTTACAGATACCGCTAATAAATTGCAGTAGTCCTT
CCCATGGAGCCAAAGTACATCCTTGGAATCTTTGTCCACACAGCAGTCAAGGCAGCTATG
GCCAATCAGCTGAGGGTGTCATGTGATGGAAAAATCTGTTTGCTGTTCCTGCTTTATTGT
TTGCTTTCTGTGTGCTGTCATATTTTGGTATCAGAGTTACATTAAATTTGCAAAATGAAT
TGGAGTTTTTTCTGTCTTTTAATGTGCTTAGGTAGTTGTGGAGTGGCATCTTGGGTTCGT
AGAAGAGCTGGAGATCAGCATAGCTCTTTGGAGAACGTGGGTCTCCAGCTTTTGGCTCAA
AGGCAAATATGACTTCAGCAGGATAGAGGCCTGGGGAAAGCATGGCAGGCAAGAGGATAA
CAGGTTGAGGAAAGATATGGAGAGGGAAAGCCTGGAGCAGAAGGCAAACGGAGAGGCTTC
TGGACAGTAAGTACAGATTCATTTTGAATCACTGGTGTAAGAATGGAGGGAAGGGCAGAG
GTCACTAGGGGTGGACATAAGAACAAGGGAGGGTTTAATTGGGATAGGAGAGGAAAACTT
GGGCATATTGTATAGACTGTGGGGCAAAAGCTAACAGGAACAGGAGATAGATATGGAAGA
GTCAGGAATTGACTGAAGTAGCCCATCCCTGAGAAGGTGGGATGGAATAGGGTACCAGAG
AAGACAACCCTGACTTTGAACAGACTTAAGGGTGGCTGTGGATGCAGATAAATATAGATC
TGCTTCAAGCAGGGATCAGCAACTTCTGTAGTAGACAACAACAACAAAAAAAGGAGAGGT
GGATTATACAAGGTTTAGGTCTTGCTGGGTGGTTGTGATGGAAGGACAAGGGAACAAAGG
CAGCAAGTGTATGAGTCTGTCTCTTTACCACTGGGTCACTGGTACCTGGCTTATGGTAGC
TGCATGGAGAGTGGCTGAAGAGATGGCCCATAGTATCCAACATAGTTAGGGACAGAACAC
TAAGGATAGATTGGGGGACAATAGAGCATTCAAAGGACTCTGCTCTTGATGCTGTACAGC
AACAAATATTGTTCATTCAAAAAATACTATAGGGCTGGGCACAGTGGCTCATGTCTGTAA
TCCCAGGACTTTGGGAGAGGCCAAGATGGGAGGATTGCTTGAGNNNNNNNNNNCCCCAAG
GTAGGCACAGGTCTTCCCTGAGGTATCACCTCCCCTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1063, 4869..4942, 7106..7210, 7460..7523, 7779..7858, 8382..8473, 9200..9279, 9373..9415, 9833..9895, 10445..10559, 11381..11488, 13691..13916
4898..4942, 7106..7210, 7460..7523, 7779..7858, 8382..8473, 9200..9279, 9373..9415, 9833..9895, 10445..10559, 11381..11488, 13691..13822
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved