Pan_troglodytes Locus MAGED2
snOPY snoRNA Orthological Gene Database
Pan_troglodytes MAGED2
Pan_troglodytes
MAGED2
X
SNORA11
6234..6361
8547
GAGGAGCAGGGAGCGGGGGAGGGGCAGACAGGCTGGGACGGAGGCCCCCTAGGGAGGCG
GAAAGGGGCGGGACCACTTCCGGCCTAGAGAGGGGAGGGCAGTCTCCGAGTTTCGGAGGG
GCTTGGAGTGAGTGGACGCACTCGGGAATTGTAGGAGGACGAGGTGAGCAGCCGGGTCGG
CTTTTGGATGAGAGCCCCGCTAGGGGTCGGCCCCACCCTCTGGGATCTGGAGAAAACCTG
CCTTAAGGACCGGATCGTACCGGATCCATCCGGCTGGGAAGGGAGGGGAATGGACCCGGT
TTGGCCGGGCCCAAGATGGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNGACGTTCAGTGGCTTCACTGANNCCCAGGCTT
CTCCCCCTTCAGGCTCAGCTCTGCCAGGGCCAAATTGAGACATGTCTGACACCAGCGAGA
GTGGTGCAGGTCTAACTCGCTTCCAGGTAAGGCCTCTTTCTGTCCTTTCTCCAGCTGCTT
TTCCTCTCCAGCCCTTGTTGCTGCCCCCAAGTCCCTTGGCTCTTCCCCTCCCATCCTTGT
CCTTCTCCACCTACTTTCCTGCCTGGGTGTCCCCCTGCCCAGTGGAGGGAGGGAGAGAAG
GTGGGCGGGCCCCTCTTCTGCCATCAGTTCTTGCTCAGAGGAAAGGGAGGCCTTGTTGGG
CTGAGGTGGTCAGAGCACACCGCAGGTAGGAGTCAGTACAGGTCAGAGAAGTGTGGCCTT
GGAATTTTGGAGCCATTTGCTTAGTTGGGGGTGGGGAGAAGGTCTATGAACTTCCCTGCT
TCCTCTTGCAGGCTGAAGCTTCAGAAAAGGACAGTAGCTCGATGATGCAGACCCTGTTGG
CAGTGACCCAGAATGTGGAGGTCCCAGAGACACCGAAGGCCTCAAAGGCACTGGAGGTCT
CAGAGGATGTGAAGGTCTCAAAAGCCTCTGGGGTCTCAAAGGCCACAGAGGTCTCAAAGA
CCCCAGAGGCTCAGGAGGCACCTGCCACCCAGGCCTCATCTACTACTCAGCTGACTGATA
CCCAGGTTCTGGCAGCTGAAAACAAGAGTCTAGCAGCTGACACCAAGAAACAGAATGCTG
ACCCGCAGGCTGTGACAATGCCTGCCACTGAGACCAAAAAGGTCAGCCATGTGGCTGATA
CGAAGGTCAATACAAAGGCCCAGGAGACTGAGGCTTCACCCTCTCAGGCCCCAGCAGATG
AACCTGAGCCTGAGAGTGCAGCTGCCCAGTCTCAGGAGAATCAGGATACTCGGCCCAAGG
TCAAAGCCAAGAAAGCCCGAAAGGTAAGACCTCTGCAGTCACCACCCTTGGTTTTCTACT
CCTCTCTCAGTTGGTTCATTTGTTCTACAAACATTTAGAAAGATCCCTGTGCTCATCAGG
GCTGTGGGGGGCACTGAGAGTAATGTGATGTAATTCCTGTCTTCAGAGAGCTTGCAGACT
GATGGGGAGGTGCAATCTGAATGTAATGCAGTTTATGTTTACATAGTAGCTGCCCTGTAT
TAGGCCTTGAGCTAAGCACATTTATGCAGGTTATCTCATTAAATCTTGAAAGTAATTCTC
ATAGCCCCAATTTTATGGAGAAGGAAGCTGAGTTCCAGAGAGGTGAAGCGGCTTGTCTAG
GATGGTTCAAGCAGAGCCAGTAGTGGGCACAGAAAGAGAAGAAGACTCAGCCTCCACCCA
CCCTTGGTTTGCTCCTGGCCTGCTAGGCAGATGAAACACCTGCTTGGAAGTCAGTGAGAA
ACAAATCCAGGGTTCAGCATGGCCAACATCTATTGAGTCAGGCTGTTACTACAGGGGTGG
GATTAGCGGGTGCTTCCTGGAAGAGATAGGGAGAGGAAAAGGACCACTTGCTTCATCTGG
TGACGTTGAGCTTCCTCTCTGTTGATGCAGGTGAAGCATCTGGATGGGGAAGAGGATGGC
AGCAGTGATCAGAGTCAGGCTTCTGGAACCACAGGTGGCCGAAGGGTCTCAAAGGCCCTA
ATGGCCTCAATGGCCCGCAGGGCTTCAAGGGGTCCCATAGCCTTTTGGGCCCGCAGGGCA
TCAAGGACTCGGTTGGCTGCTTGGGCCCGGAGAGCCTTGCTCTCCCTGAGATCACCTAAA
GCCCGTAGGGGCAAGGCTCGCCGTAGAGCTGCCAAGCTCCAGTCATCCCAAGAGCCTGAA
GCACCACCACCTCGGGATGTGGCCCTTTTGCAAGGGAGGGTAAGAACTCTGTCATTTTTA
TTCCGCCTTTTCTACTGCCTTGGTTGCCCTTTTCTTTGCCATCGTCTCAAGTTTTCTGCA
AACTTGTTTTGGTCTTTCCATCTTTTTCTACTCTGCCAGGCAAATGATTTGGTGAAGTAC
CTTTTGGCTAAAGACCAGACGAAGATTCCCATCAAGCGCTCGGGTAAAGTCCTACCAATC
CTCCCTCTGCCCTGAGCTCTGCCCTCCATTGCCCTTACACCATTGTGCTGGGGATATCCC
CTGCTCTTATGCTTATATCTCTGTCCTCCCAAAGTTCTAATTTGGCAGTGCTAGCATCTC
TGTTGATAAGCACAGAACCGGGTTATGCCACCCTTGGTGTGGTTGGCAAAGAGTCTATAG
CTTGGGCATCAGGGCCACCTGGCATCTCTTCAGTCAGGTGCTCACAACACTCTCCCCTTG
CAGACATGCTGAAGGACATCATCAAAGAATACACTGATGTGTACCCCGAAATCATTGAAC
GAGCAGGCTATTCCTTGGAGAAGGTGAAGGGGCAGCCCTGGGGGATGGGCACAGTGGGGA
AGCCTTGAATTGAACAAAAATGTACAAGTCCCTTCTCGGGAACCAAAGAGACCTGCTAAT
CCAGCTCCCTCGCTATGCTGAGGGGCAGACAGTGGCCTAGGGAGGGGTGTAGATTAACGA
TGGGTCACACAGCAAGTCAATGGTAAAAGTGCAGCTANNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNTGCAGGCATACTGGGAACGTAAGCTGGGAAAGGGCTGAGGTG
TGGGGGGCTTCTGCTTTGGCCATGTGCTGCTACCCCTTCTTTGTCCTACTTCCCCCATCC
TCTTAGAGAGTCAGGAAAGACAGGGTCTTAAAAGCCCCGTCCCAGTTCCTATGCATAGTT
GGAGCCCTGCTTACAGTAGTGGCACCTGATTATGATTGACTGGAGGGTGTAGGAGCCTGG
AGTGGGACATTCCTGCTGTCAGGTTTGCTGTCTCTGTAGAAGCTTCCCAGGAAAGCAGGC
CTGTCGTTGCTTGCCTCTTCCTACTGGGTGCCTGGCCTGGCTTTGGCAGAGTGGTTCTCA
AGGAGGGCTTCCTGGTGTGGCTGGATCAGTATGCATGAAGCGCAGGAGTGTCAGTGGGGC
TGAAGGTTCTGGGACAGAAAGAAGGGACTCACATTGACTGAGTGCTTGTGTTGTACCAGG
TTGGCAGCCATTCTTCCATCTTCTTGGAAACCCAGGGAAGGGAAAATATGATTTTTCTAT
TTTACTGAAGAGTAGACTGAGGCTTGCAAGTCTTAAGTGCCTTGCCAAGGGTGGCATAGA
GCTGGAAGCAGAGACTGGGTAGAATTCTGTATCTGAGGAATCTGGGAGAGGCTAGCCTAG
TGAGTTGGCTGGCGTGTCTGTTGCAGGTGGCTGCTGAACATAAACCTCTCTGTCCTGTTA
TTTCTCTAGGACTAAGGACTCACCCAAGCTGGGTCTGCTCATGGTGCTTCTTAGCATCAT
CTTCATGAATGGAAATCGGTCCAGTGAGGGTGAGTGGCTGGGCTTGCAGCTGAATGGGTG
GCTGTGGTCTAGATTCCATGTGTTCAATTTCTGTCCCTGTCTCCTCTTGCCTCCCCTCGC
AGCTGTCATCTGGGAGGTGCTGCGCAAGTTGGGGCTGCGCCCTGGGTATGATTGGGCTCT
CTCAGCGCTTGCTGTCCATGTTGTCCTTTGGCAAGAGAGGACGGTCCTAGGATTGCATCA
GTCTGGTGGTCTGGTGGAGCGGGTGGGGTGCTGGACTGGGTAGAGGGCCCAGGGTTCTGA
CCTGGGTGGATGATGGGCGAATGGTCCTGAACTCTCTGCTCCCTCTCTCAGTGTCTCTTG
GGCTTCTATGGAGCTTCCCTCTTGTGCTGGAAACCTCTTTTCCATCTTGGAAATGCCTCT
GCCCACATCTGGGAAGTGCCATAGCCTTGAGTGAATTTATTTGTTTATTTATTTTTCTTT
TTCTTCTCTCAGGATACATCATTCACTCTTTGGGGACGTGAAGAAGCTCATCACTGATGA
GTTTGTGAAGCAGAAGTAAGTATCTCTGTCTGGTGTTCATGTGTTCCATGCATTTGGCCT
ATTTCAGAACTGAGTGATAAAGCCGTGGTGCATGGATGCATGTGTCTATGTGTGTACGTA
TTTGCATATTTGCATGTATGCAGGTGGGATTATTCCTTGGGCAGTGATGGGAAACAGGAG
CAGCACATGTTTCCTGATCTGTTACATATACCTCAACATTTGTCTTGAGACCAGTTCTGC
AAGGGAGAGATTATCATTACCATCATTGTACGTATGCAGAAACTGAGGTTTAGAGAGGTG
AAGTCATTTGGTCAGGGTTACACAGGTAGCAAGTAGAAGAGTTATGTTTAGAACTTGGCT
CCAAAGCCTTAGTTCTTTTTATTCTGCTAACTAGAGCTTCATAGAAATTAATTTCCGTAA
AGAAATGACATAGAATGGTAGCTTCAGGCAACCAGGTACCATGCTGGGGAGTTGACTTGT
ACATCTCATTTCATTTTCATAACTACCCTGCAGCTGTCATCCCATCCCCGTTTTACAGTT
GAGGGACCTGGGGCTCTGAGAAGGGAGATCTGAGCATGGCCCACAGCTGGTATGGGCCTG
GAGCCCAGTCCTCTTGAATTTCTGGCCAAGGCTCACCTATCCTTGGTCCTTGGAGGACAT
GCAAACACTCACACAGCCACACGCATGTGCACACAGAAACACACACAAAGGGTCAGGAAT
TCAGCATGTGTGAAGCATGCTGCTATTGGCTGTTCTTCCTCTGTAGTCTTTCTGGTCATT
TTCTGTGGTGGACCTTTCTGGGCTTGGCCAGGCTGAGGCCAAGACACTTGCAGTGGGGTG
TGCTCAGAGCAGGGGGCCCAAAGAATGGCTCCTCTGTTTACAACACACCCAACAGGAATC
TGGGGTCATTGTGATGAGGGCGTCAAACTTGTGGCTTCCCTATGAACAAATGTCCCCCAA
CACCTCTATGTGGCTTCTGGGCAAGACCAGTGGGACAGGGCTCAATATTGGAAGAAAGAC
TGTAGTAATTAGTGGATAATGTTGCTATCTGGAGCCTGTCCAGTCTATGCATGGGTAGGC
CATGAATGGTCTTAGAAATAAAGGCTTTGAACCTCTCTTTCCAAGGTACCTGGACTATGC
CAGAGTCCCCAATAGCAATCCCCCTGAATATGAGTTCTTCTGGGGCCTGCGCTCTTACTA
TGAGACCAGCAAGATGAAAGTCCTCAAGTTTGCCTGCAAGGTAATTGGAGAGCTCCTTGA
GCTTGGCAAGTCAAGAGCATGGGGTGCCCCTGGCTGGGGCAGGCTGTGTGCAGAGCAGCC
TGCAGTTCAAATCTGAATGTTTTGGTGCTTCTGTTAATTGTCAAGACACCATAACAGGCA
CTTTATCTGAATCATTTAAGCCTTACAACCTGATATGTCATTGCCCTGTTACAGATGAGA
AAACCGAGGCCCAGAAAGGTTGGTAGGTGACATGTCCAAAGTCATGGGGCTAGGAAGTGT
CAGAGCAGGGATGGAATATTAGGTGCATAATTACTGGTAATACTGTATTATTACTATTAT
CTTTTTATACTAAGCATGTAGCATAGTGCCTAGCATAAAGAGTAGATACTTAATCCTCTT
ATGCTCCTTCTGATGGTTATTTACATAGTAATACTGTATTATTACTATGGCTTAATCCCT
CTATGCTCCTTCTGATGGTTATTTTTGTTTCAGGTACAAAAGAAGGATCCCAAGGAATGG
GCAGCTCAGTACCGAGAGGCGATGGAAGCGGATTTGAAGGCTGCAGCTGAGGCTGCAGCT
GAAGCCAAGGCTAGGGCCGAGATTAGAGCTCGAATGGGCATTGGGCTCGGCTCGGAGAAT
GCTGCCGGGCCCTGCAACTGGGACGAAGCTGATATCGGACCCTGGGCCAAAGCCCGGATC
CAGGCGGGAGCAGAAGCTAAAGCCAAAGCCCAAGAGAGTGGCAGTGCCAGCACTGGTGCC
AGTACCAGTACCAATAACAGTGCCAGTGCCAGTGCCAGCACCAGTGGTGGCTTCAGTGCT
GGTGCCAGCCTGACCGCCACTCTCACATTTGGGCTCTTCGCTGGCCTTGGTGGAGCTGGT
GCCAGCACCAGTGGCAGCTCTGGTGCCTGTGGTTTCTCCTACAAGTGAGATTTTAGGTAT
CTGCCTTGGTTTCAGTGGGGACATCTGGGGCTTATGGGGCTGGGATGAGGAGCTGGATGA
TTCTAGGAAGGCCCAAGTTGGAGAATGATGTGGAGAGTGTGCCAAGACACTGCTTTTGGC
ATTTTATTCCTTTCTGTTTGCTGGATGTCAATTGACCCTTTTATTTTCTCTTACTTGTGT
TTTCAGATATTGTTAATCCTGCCAGTCTTTCTCTTCAAGCCAGGGTGCATCCTCAGAAAC
CTACTCAACACAGCACTCTAGGCAGCCACTATCAATCAATTGAAGTTGACACTCTGCATT
AAATCTATTTGCCATTTCTGAGTTTATTGCTTTTTTTGGCGGGCTGTCACATTTTGGTAT
CACATTTAAAAATCAGTGAGTTGGGAAAGTTTCCACCTCAGTCTGTGTTTAGTTTGAGGT
GATATTGTTGGATTCCCAGGAGCGAGATTAACACACCTTTCTGGGATAGATTGGGCCTCA
CGTCTAATTGTTGGATTCCCAGGAGCGAGATTAACACACCTTTCTGGGATAGATTGGGCA
TCACGTCTAGCCTTCAGGGTGGTGGGATTTTAGTGGAGTGGAGTTCAAGAGATTGTAGTT
ACAGAGGACACACTTTGAAGGAGAGGCTTGAGGTCGGCAAGTCTAGAGCAGAAAGTGTAA
GTAGAGGAGACTGGACATCAAATATAGAATCCCTTTTTGAGAAATTTGAATGAGGAGAGA
GAGGGGTACAGAGCTAAATGGAGATACAGGAACAAGGGAGCATTTTCTTGGGGAAGGAGA
GAGAGACTTGAGTAGGGAGGAGTCAACGGAGAGGGAGAAGTTGAATGTTGACTTTTGCAG
CCCAGTCCTGGAGGAGGTGAGAGGAGTTGGGTTGTGGGAAGGCCTGGGAGAAGGGACTAC
TTGGATAGGACTCAGAGAGGGGGACTGTGAGAGGATGTTGAGCAGTAGGGAGGCCCCAGT
AGAGGATGGAGCCCATGATTTTTGGGGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1045, 1391..1882, 2490..2798, 2919..2982, 3243..3322, 4099..4115, 4809..4888, 4982..5024, 5352..5414, 6525..6639, 7113..7547
1001..1045, 1391..1882, 2490..2798, 2919..2982, 3243..3322, 4099..4115, 4809..4888, 4982..5024, 5352..5414, 6525..6639, 7113..7544
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved