Pan_troglodytes Locus XR_023691.1
snOPY snoRNA Orthological Gene Database
Pan_troglodytes XR_023691.1
Pan_troglodytes
XR_023691.1
X
SNORA11
6336..6463
8781
GGGGCTTTTGGTGATGAGGACGGGAGCCACTGGAGGCCTCGAGAAGGCAAGGATCCAGC
CCCAGACAGGCCCGGGAGAGGGAGAGTGGAACCCGACACGCTGCGCCCTCCCTCCGCCTC
CGGATCTGAACAAAGCCCAAGCACTCAGAACCGGAACCCCATTAGACCCAAGGTCTAGAT
AGGAGCCCCCATCACCATCAGACCCAGGAGCCCCGATCTGAGCCCTACTGAAACCGGAGC
CCAGGATCCTCACCCCTTTAGCAGACCCGTGTGCTCCGAGCTGAGCTCCCTTGGACCTGA
GGCCCCACCCCCACCCCAACCACTCCTAGATTACTCGAACCGAGCTGACCGCTTGCCCCC
TTCCTGGAGTGCCCAGTCCTCGCGTTTGAGATCTGCAGCGCTCCGATTGGAGCCTCACCT
AGGTCTGAGGCCCCCACTCCATCCGCCTCTAGTGCTCGAGTCTGAGCCCCACCTAGGCCC
CCCGCCCGGACCTAACCAAAGGTCCCTGGGGTTCTGTTTCGCAGAGCTTGCGGCTTGCCA
CTGTCCCTGTTGTCTGAGCTCTCCCATCTGCTCCCCCTTCATCCCGGTCCCCTTCTCTGG
CCCGTAAATCCAAACCCTTTGTTTCTCTCTTCCCCAATGCATCCCCTTTGGGACTCTTCG
GACCCCAGCCCTCCAGAACACCCCCTAGTCAAATCTAGCCGCTGGGATGGCGAGCCTGCC
CATCCTAAACTCCGCTTTCAGTGCGGCGCCTCCTGCGACCTCCTCTGTCCCTTTCCTTGG
GCTCTGTCCCTGACCAGGTCTACCCCATCAGAAAGCCAAACCGTCTCCCCCCCCCTCCTC
CACCCCCCCGCCCCCTACTGCCTAATACTGCCTAGTAACCTGATGATTGTCGCCCCTCAC
CTCCCGGGAGATCCCGCCTCCCATTGGATCCCGCCCCCTCCCCCTGCAGCTGCTTCACCC
TCCCTCTCAGGCTGAGCTCTCATCTCCCTGGGACCCGCAGCATGGCTGAGGGAAGCTTCA
GCGTGCAATCGGAAAACTACAGTGTTGAAGACATGGATGAGGGTAGCGACGAAGTCGGGG
AGGAAGAGATGGTTGAAGGCAACGACTATGAAGAATTCGGTGCGTTTGGTGGCTATGGCA
CCCTCACCAGCTTTGACATCCATATCCTCAGAGCCTTCGGAAGCTTGGGTCCAGGCCTTC
GCATCTTATCGGTGAGGCCCCTTCCTGGACACCTGCTGGCCTGGGCCTTTCCCCTGTGAA
TGGGGGAGGGAGGAGGGGGGAGCAAGGAGGGTTGTGTGGGAAAGGACTGCCCAGCTTCCC
AAGCCTTCCCTCCCCTGCTCGGAAGAAGAAGATTTGGGAAGGTCTTGGGGTGTTCAGGGC
TGACTGCTGGGAAGAGGCTGGCCAGCACAGGGAAGCTAACACAAGTATGTCGTCGAGTGG
CCTGCCTTCCCCAACCCCTCTCTCTGGCCTTGCAGAATGAGCCCTGGGAACTGGAAAACC
CTGTGCTGGCCCAGACCCTGGTGGAGGCATTGCAGCTGGATCCGGAAACACTTGCCAATG
AGACGGCCGCCCGTGCTGCCAACGTAGCCCGCGCCGCCGCCTCCAACCGTGCGGCTCGGG
CCGCTGCCGCCGCTGCCCGTACCGCCTTCAGTCAGGTGGTCGCTAGCCACCGGGTGGCCA
CGCCGCAGGTCTCAGGAGAGGATACCCAGCCCACGACCTACGCCGCCGAGGCTCAGGGGC
CCACCCCTGAGCCACCCCTTGCTTCTCCGCAGACCTCCCAGATGTTAGTCACCAGTAAGA
TGGCTGCCCCCGAGGCTCCGGCAACCTCCGCACAGTCCCAGACAGGCTCCCCGGCCCAGG
AGGCTGCTACTGAGGGCCCTAGTAGCGCCTGTGCTTTCTCTCAGGCTCCGTGTGCCAGGG
AGGTGGACGCCAACCGGCCCAGCACAGCCTTCCTGGGCCAGAATGATGTCTTTGATTTCA
CTCAGCCGGCAGGTGTCAGTGGCATGGCCTTCCCGCGCCCCAAGAGACCTGCCCCAGCCC
AAGAGGCTGCCACAGAGGGCCCCAGTGCTGCCTCTGGTGTGCCCCAGACGGGACCTGGCA
GGGAGGTGGCAGCCACCCGGCCCAAGACCACCAAGTCGGGGAAGGCGCTGGCCAAGACTC
GGTGGGTGGAGCCTCAGAATGTTGTGGCAGCAGCTGCTGCCAAGGCCAAGATGGCCACGA
GCATCCCTGAGCCGGAGGGTGCAGCTGCTGCCACTGCTCAGCACAGTGCTGAGCCCTGGG
CCAGGATGGGAGGCAAGAGGACCTAGAAGGTGAGATCCCCCTGCCCCCTGNCNNACTCAC
ACCCCCTTGCTCCTGTCCTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTCGCCACTGTGGTGGATTCCTCTCTTCTCCTCTTTCCCCTCCT
TCTCTCCTCACCTCCCCTCTCATCCCCTCCTCTCCTCTCAGCTAGTCCATGTTTCTCCAA
CACAAGTTTGCTGAGCATGTTTTCACTCCACGTAGTCCCTACCCTCAGGACTGGTGGGAG
AAGAGGCTGGCTCAGTGCCTGGCACTTAGTAAGCACGCAGCACATGCCAGCCGCTGCTGG
TACTGCTCTCATTTCCAAGAGCCTGCTACGGGTGAGGTGCGTGCCGGGTGCTTTGGCACG
GGGAGCCTGGTAGCCCTGGGTCTCTCCTCTCTCAAATGATACAGTCCAAGCACCTGGATG
ATGAGTATGAGAGCAGCGAGGAGGAGAGAGAGACTCCCGCGGTCCCACCCACCTGGAGAG
CATCACAGCCCTCATTGACGGTGCGGGCTCAGTTGGCCCCTCGGCCCCCGATGGGCCCGA
GGTCCCAGATACCCTCAAGGCACGTACTGTGCCTGCCCCCCCGCAACGTGACCCTTCTGC
AGGAGAGGGTAAGAAGCCCACCCTCCCCCATCTCCTTCCTCTCCTCCCTTGTGGGCCACG
TCTCTGCTGTCACCCATGCCTTGACCTCCCCGCGTGTTCCTCCTTCTCCAGGCAAATAAG
TTGGTGAAATACCTGATGATTAAGGACTACAAGAAGATCCCCATCAAGCGCGCAGGTAGG
CAGCCTGTGCCCCCTTCACCATCCCCTAGTCTGTGGGCATCCCTTTGCTTGCGTGCCACG
GCTGGTCCCTCCATAGCCACAGGACGGGGTCCTGGCTGCGTCACCCTCGGCAGGGCTGAC
CAAGGGGCTACAGCTCTATGACCCCTGCTCAGCCCAGGTGCTTTCTCCAACTCTTCCCCC
TCCTGCAGACATGCTGAAGGATGTCATCAGAGAATATGATGAACATTTCCCTGAGATCAT
TGAACGAGCAACGTACACCCTGGAAAAGGTGGGTGCAGGATGGGAGCAGCTCTGTGGGGG
AAGAGCGGGCATGGGGGTGCGGTGACCCTGCAGCCCCTCAAGGCCCAGTCTCTGGAGCCA
TCTCTCACCTCTCCGACTCTGAGCTTCCACTGCACTGGCAGTTTGACTCGTGCTTCCTGC
CCTCGGCTTCTCTCTCTCATGCTCTCTGAGTGTCTCGCCGTCTGGCCAGGTGGGTCTCAT
CGCCTCTGCCAGCGTCAGCTCCCACAGCGAAGGTCTTCCGTGTGCTGTCTTCTTCTGCCC
TCGCTCACGAGTTTGGATTCCTTGCTGAGGAGCAGTTCTAACCCGGAATCACTGTCTGCC
GGCAGGATGCCCAGCATGGGGTTTGGATCTCACACTCTGTTTTCTCCCCCACGTAGAAGT
TTGGGATCCACCTGAAGGAGATCGACAAGGAAGAACACCTGTATATTCTTGTCTGCACAC
GGGACTCCTCAGCTCGCCTCCTTGGAAAGTAAGAAAGGGAAAGCGGGTCGTGGCCTTCCT
CGGTGGTGTCCCTTCCCTGCCCACACCCCTTCAGTGAAGCAGGAAGACGGGGCTTGAGTG
CGGCGCACGGCTCCCACACACAGCGAGGGCTGCCTGGTGACTGCTGGATGAAAGGAATGA
TAGCCTGGGGTGAGGCCTTGCTGCCATCAGTTCTCCCCAAGCTGCTGCCGGGCTTTATCC
CCAAAGCTTCGGAGGAAAGTGCCTCTTCCTCCCGCCTCTTCCTCCTGCCTGCCTGGCCTG
GGCCCGGCAGAGCTGGCCTAGGGGAGAGCTTCCTCTTCAGTGTAGGTGCTGATGTGGAAG
GGGCAGGAAAGGTCTGGAGCCATCTCTGGGCACACGTTTGCCATTTGCAGAGCTTCGGCT
CCCTGCCTCGCCCTGTCCTCTGCAGAACCCTGTCAGGGAAGTGTTAGTACCCATGTTTTA
TAGAGGAGGCGATTAAGTCTCAGGCGGAGGTGCGAATGGTCTGTCAGCAGCTAGTGAACT
GTGCCTGTCCTGGGAAGAGTTCCCCTCAAGCTGGGAAACCTGAGAGAGGCTAGTTGGGAG
AGCCTGGTGGTGTCTCTCAGGCAAATAGCTGCTAAACAGGATTTCTCTTTCCACACCTTT
AGAACCAAGGACACTCCCAGGCTGAGTCTCCTCTTGGTGATTCTGGGCGTCATCTTCATG
AATGGCAACCGTGCCAGCGAGGGTGAGTGGCTGGACCTGCAACTGGGGGGCTGCCCATAG
TCTCATCTTCTGGGTGCCAAACTCTCGTACCTCCTCTCCCCTCGCAGCTGTCCTCTGGGA
GGCACTACGCAAGATGGGACTGCGCCCTGGGTATGATTGGCCTCTCCAGCTCCTCCCCTC
GGTGCTATCCTCTGGCCAAAGAGGTCCTGGGATTGCAATAGCCTGGTGGTCTGGCGCAAG
GGCGTGGGGTGCCCTGGGCTCGGTAGAGAGCAAAGGATCTCACCAGGGCGGATGGGGAAG
CGGTGCTGGATGCTGCTCAGCCCTCTCTCTGCTCTGTGGCCCCAGATGACATCTAAGAGA
GACAGTCAGAGTCAGGGGTTCCATCAAATCCCTACCTGGGGCGTCCCTGACCAACAGTCC
TCTGGCCTCTGCTGCATGCCCAGGCCTCCACAGCGACTCCCCGGGGGCTGGGAAGTCATA
GTCATGCTAGGGAGGGCCCCTGCCACCGTCTCTGCTCATGGATTCCTTTCCTTGCCCTCA
GGGTGAGGCACCCATTCCTCGGCGATCTGAGGAAGCTCATCACAGATGACTTTGTGAAGC
AGAAGTAAGTATCACCTGAGCTAACTGCGGCTCTCACTCGAGCATCCTTTGTGTGCTGGT
CTGGCTGAGAAAGCAGTTCCCTATCCCAAATCTTCAACTGGAGGGATGGGTGCCTCTGAC
CTGGGAGTGAGTGGCAGTGGGGGTATGCGAGTGTGTGGGGAGCCGAAGGCCAGGGCGGTC
TTGGGAAAAGGGAGCTCACGTCACCTGAGAACACGGTGTGGGGTGTGAAAACGGCCGCCA
TCACCTTGAGCACCTGCCCTGTAGACTGACACAAAGAGTTCCCCCTGGTTTACACCTAAG
GAACCCGGAGCTCAGAGAGGAGACGCCTCTGAGCATGGCTCCCAGCTGGTAAGGGCCTCA
GCCCAACTCTCCTGATTTTCAGGCCAGGGGCCACCCTCTCCCCGTCCCTGGAGGACTTGC
CAAAGCACAGGCGCGCATGCACACCAACAAAGGGTCAGGACTTGAGGAGGATGCCTGGAG
CACGCTTCTCCTGGCTGACTGTTTCTTCCTCTCCAGTCGTTTCCTCTGGTGGGCCTCTCC
AGGGCTCCGCCGGGGTGTGGCCAAGACCCTGGAGGTGGGGTGTGCTCAGAGCAGGGGGCC
TGAAGAATGGCTCCTCTGTTTACAACACACCCAACAGGAAGCTGGGGTCATCGTGATGAG
GGGCACAAACTTGTGGCCTCCCTACAGACAAACGCCCTACATGTGGCCCCCCTGTACCTC
CGCATGGCTTCCGGGGAGGACCAATGGCAAAAGGCTTTGAAGGCCTCACTTTTGCAGGCA
GAAGTCCTGGGAGTGGGTTTGGGAATGAGTGAAGGGCTGGAGGGGCAGGACAGTCCTCTT
CCAGGAGCTGAGCTGCGGCATCGGGTTGAGGAGGGGCCCCCTGGAACCCATCCGTTCAGC
AACAGGTCTGCTTGGCTAGAAGCAAAGTTTACTTTCCTCTCATGCCAAGGTACCTGGAAT
ACAAGAAGATCCCCAACAGCAACCCACCTGAGTATGAATTCCTCTGGGGCCTGCGAGCCC
GCCATGAGACCAGCAAGATGAGGGTCCTGAGATTCATCGCCCAGGTAAGGGAGAGCCTCT
GTTGGGTGCCCGGCACCGGGGGTGGTGCTCTCCACACCTTGCTTGTTTCTTGGTCGAGGC
CTCCTTCCCATTACCCCGTATTCCAGTGAGGGTACCAAACACTCACAGAGGCACCTGAGC
ACCCTACACAAGGTCACAGATGGGGCAAAATCCCAGGTCTGGCACAGGAGAGTAGGAGCC
CCCAATCCCTGTGGTCCTGATTTTTGCCATCATTGCACAAAGCACACGGGAGGGGGTGAG
GCGGGCCGCGGGTGCTCAGCCAGTGTGGGGTAGCTCTGTGTCTATGCTTGCCCTTTTCCT
CCTCAGAATCAGAACCGAGATCCCCGGGAATGGAAGGCTCATTTCTTGGAGGCTGTGGAT
GATGCTTTCAAGACAATGGATGTGGATATGGCCGAGGAACATGCCAGGGCCCAGATGAGG
GCCCAGATGAATATCGGGGATGAAGCGCTGATTGGACGGTGGAGCTGGGATGACATACAA
GTCGAGCTCCTGACCTGGGATGAGGACGGAGATTTTGGCGATGCCTGGGCCAGGATCCCC
TTTGCTTTCTGGGCCAGATACCATCAGTACATTCTGAATAGCAACCGTGCCAACAGGAGG
GCCACGTGGAGAGCTGGCGTCAGCAGTGGCACCAATGGAGGGGCCAGCACCAGCGTCCTA
GATGGCCCCAGCACCAGCTCCACCATCCGGACCAGAAATGCTGCCAGAGCTGGCGCCAGC
TTCTTCTCCTGGATCCAGTAAGAGTTTCGGTAGAGAAATGAGACTCTGCAGGAGGGCTGC
GGAGGGGGGTGAGATGTCAGAGGGAGGGCCGGGGTGGGGGCGCTGGGGGCAACGGCAACA
GCATGGACGGACACTTATTTTGTTACGTACACCCCTCCCTGGTTCGCGTGTGTCCACGGA
TGTTGTCACTTGGGTTTCTTGTGCTTTTATAGGCACCGTTGACGAACTGCAGCGATCTTA
CTGGCCAAGCCAGAGCGCCTCCTCTCAGATTCCTTCTCGACACAGCACCCTAGGCGGCTT
CTTCCTGTCAGTCGGAGGTGGCATGCAAGATGAAGCTCTCTTTGCTCTTCCTGCTTTCAT
TTTGTGCTTTTCCTTGTGCTTTCATGTTTTGGGTATCAGTGTTACATTAAAGTTGCAAAA
TTAATTTGGATGTTTCTTCCTTTACCTGCACACCCATTGCTATACCTGGCCACGCTTGGG
CTTGTAGCAAGGAAACTTCTTCAGGCTCTCTGGGGTAGGTGGGCCCCACCTCTGCCAAAA
AGGCCCACGGGGACAGGTGGGATGCTGGGAGGTGCGGAGGTGGGTTACGCCTGAGTGCGT
GAGCAGGAGTTTGGAGAGGCCCCAGTGCTCATCGTTATGTGATTTTCTACAAGCCTTGCT
CAGCAGCCCCAGGGACATGGCAAGAGTGGGGGCCAGAGCAGGGGCGGGGTGGAAAATTGC
AGCTTGGTGCCACTGCCCCTCCCGCCGAGGGACAGGGTCCAAGGCTCTCACCAGGACCCA
CCTCCCACACCCCCTCCTTGGAGATGATGTTCCGGAACCCTTGGCTCATCATCCACACAG
TTCAGGACCCCGTCCTCGGTACAGAGTCTGACGGACAATGAGGTGGGCCCCGCAGTGACG
TTCGCAGCCCTCCAGTGGGTAGAAGGAGGGGCCGTGATTGCTGAGGGAGCAGGATGTAAT
AAAAACAACGCACGGTGCACGCGTACACAGCCCCTTGCCTGTGACGGAACGGCGGCCTGT
TTGGAGCTTCGCAGCCCTTCTCCCCCAGCAGCAGGGCTCTCCCAGTGAGGACAACACCAG
GCCTACCTAGGTCCTGGTGTGTTCAAGGGCTGGGTGATGTCTGGAGGGGTCTGAGGTAGG
GCTGCACATGCTTCAGGTACAAGACGGTGAGGGCAGAGACAGTTTGGTCTCCTGGGAAGG
GCTCAGTGGCAGGCAGGGACAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1210, 1475..2302, 2306..2308, 3344..3547, 3651..3714, 3908..3987, 4376..4467, 5102..5181, 5267..5309, 5701..5763, 6709..6823, 7146..7576, 7772..7781
1001..1210, 1475..2302, 2306..2308, 3344..3547, 3651..3714, 3908..3987, 4376..4467, 5102..5181, 5267..5309, 5701..5763, 6709..6823, 7146..7576, 7772..7778
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved