Pan_troglodytes Locus XR_022837.1
snOPY snoRNA Orthological Gene Database
Pan_troglodytes XR_022837.1
Pan_troglodytes
XR_022837.1
6
SNORD101, SNORD100, SNORA33
1744..1816, 3248..3323, 3662..3791
5006
TGCGTCAGGCACATTGTAGGTGTTGAAAATGCACCTGAGGAATTCTGAGTTGCGCGGAA
CTGTGTATTCCGAGCACAACGCGTCGTTAAAAACCAAACAAAGCAGAACAAACTTCGTTC
AGAAGCGACTCCCGCTATACTTAGAAACTAGAATTGACCCCCTGGCTGCAGGGTTCCCCT
TTACCAACACACCGCAGGGAAAGGGCTTAGAAATAGTGAAAGCGGCCGGGGGCGGCGGGT
CACGCCTGTAATCCCAGCATTTTGGGAGGCCGAGGCGGGTGGATCCCCTGAGGTCAGGAG
TTCGAGACCAGCCTGGCCAACATGGTGAAATCCCGTCTTTACTAAAAATACAAAAAATTA
GCCAGGGTGGTGGCAGGCGCCTGCAATCCCGGCTACTCGGGAGGCTGAGGCAGGAGAATC
GCTTGAAACCGGGAGCCGGAGGTCGCAGTAAGCTGAGATCGCGCCATTGCACTCCAGCCT
GGAAGAGTGAAAGCATGTAGGCTCTCGTTTCATGAAGACAAAGATGAGGATCACACCCAC
AACGACACAAACATGGTCTCTCAGGGTGACTTAGAAGCGAAGGAACAAAGTGCGCTGCCT
GGGAAGGCTGGGTCTTGTAGAAGCAACAGGAAAGTAGAACGTGGTGTGGAAAGGGTTAAA
ACTGGCGCTCGGCGGGATACAAGGCTCTAGGTGCCTTAAAGAACACGCGGACACACTTGT
TTGGCTTCTGTCGCGCTCCGTAGAATGAGTTCCCTGGGCCTCAGTGGGCCACGCCTCCGC
AAAGAAGGACAACGCGAAGCTGCCCGCGTAGTGCCTGTTGCACTCGCCAAGGACCGGCCT
GGCAGAGATAGAAAACTCGCAGTACTCTTGCCTCAGAACCGCCTCAATCCGGAAACAGAA
ACTCCCCAGGCCCGGCACTGCGGGAGCCACCTCTTTCGAGGGTGGGAGTGCACATGCGCA
CGGGGGCCTGAAAAACCCTTAAATACCGGCATGCGTGCGGATGAGGCCTCTTTCCCTGCC
GCCGCCGAGTCGCGCGGAGGCGGAGGCTTGGGGTAAGTTGAGCGAGGCGGCAGGGGGGTG
TATTTGTTATAATTTGTGGCTCGTTGTGTTCTTGCTGGGATTCGTGACGAGTATCTGGTT
CTTTAACAAGTCAATGCTTTTGTTTTTTAGTGCGTTCAAGATTCAGCTTCACCCGTAACC
CACCGCCATGGCCGAGGAAGGGTGAGCCCAGGGGCCGGGGTTGGAGTTGGGGTCGGAGTG
CGGCTGAGGCGTGGGGCTAGAGCTGGCGGAACAGGACTGGGTCAAACGGGTGCCGTAAGC
GCGTCTGTTGTACACTTAGCCTTTCCTGAGTGCAAGGCCTTATGTGGTGTGAGGATGTTA
ACTGATGGTTTTGATGTGTCGCGTTTCAGCATTGCTGCTGGAGGTGTAATGGACGTTAAT
ACTGCTTTACAAGAGGTTCTGAAGACCGCCCTCATCCACGATGGCCTAGCACGTGGAATT
CGCGAAGCTGCCAAAGCCTTAGACAAGTACGTGTATCAGTCTCAATACTGTGGGTTCTTG
CAACCGGAACAAAACTGCCACCCAAGGGAAGAAGGCATGGAGTTCATGGTGTTAGCGCAA
AAGTTCTGAATGGCATCCGTCCTACCGGAAACCTAGGAAAAGGTATCAGAACTCAGATCT
ATAAAGCCCACTTAAAATGTGTGGGTTGCTGTTTGGAATGGGGATAAGCACTCAAAACTA
CAGTGTTTGAATGATGACTTTAATTGTCGGATACCCCTTCATTCCTTTTATGAGTGAAAC
ATAAGAGTCTGACAAACCTGTAGGTTGTGGGGCTAGTCAGTCTTATACTTATCTGGCAGA
TAGATGAGATGGAGAGCCACATTACATCTGGTAGTTTGCAAAACAAGCATTAATTTAATG
GAATTTCAAACTCAGGTTTCAGAAGCATTTGGTCCTAGATGAATTTAGTAGTATAATAGC
TGTGATTTATTTGAATTTGGGGTATTTGTTAATGTATTTGAATGGATCGAGTTAATGTGT
TTTTTAGGGTGGTGGCATTGACAAATCAACCTACTCTTGAGCTGAATTTAAATGCAGTTT
TAAGGTTTTACAGGACAAGTTCGTTTTGGTGTAATCTAGCCAGTTCAATCCGATGGAAAC
GGCATTATTGTTTAATGTATTTAGTAGGTCCTAGTATGAGTCTTCTGTATTTCTATTTCG
GCATTATTGCATGGCATTTCATAACTGTTCCATTAATGCCACAGTCTTTTTTTTCTTTTT
CTTTTTCTTTTTTTTTTTTTTGAGACAAAGAGTCTTGCTCTGTCCCCCAGGCTGGAGTGC
AGTGGCGCGATCTCATTGCAACCTCTACCTACCAGGTTCAAGCGATTCTTCTGCCTCCCG
AGTAGATGGAATTACAGGCACACGCCACCGTGCCCAGCTAGTTTTTGTACTTTCAGTAGA
AACGGGGTTTTGCCATGTTGGTCTCTGGCTGGTCTGGTACTCCTGACCTCGGGTCATCTG
CCCCCCTCGTCTTCCCAAAATGCTGGGATTACAGGAGTGAGCCATCGTGCCTGGCCTTTC
ACATGTTTGTTTAGGTATATGAAGCTGGCTTACAAGAAAGCTATTATGGTTTGGTTTTGG
CCAGAAGTTTTAAAAATGACTTATACCAATTCAGTGTGTCAGGGACAGAGGTTTTACTGA
AGACCAGTTGTAGGTTAATTGAAGATGTATGTATATGCTCCCTAGCAGGTTCTTCAGACT
CAAGCAATTTTGTACGCATTTATGTGTTCAGTGGATTGGCTGCTTATGTTTCGCAAGTGT
TAGTGCAAAGATAACCCTCCTAAAATGCAAGAATGATGGATTTGGATCTGAGTTTTAGCT
CCATTTTCATTGTAATTTGAATTTCAGGCGCCAAGCCCATCTTTGTGTGCTTGCATCCAA
CTGTGATGAGCCTATGTATGTCAAGTTGGTGGAGGCCCTTTGTGCTGAACACCAAATCAA
CCTAATTAAGGTAAGGCTGCTAAGGGTTGTGTTGGGACTAATGTTCAGTGATGCTTGCAT
ATGGGGGTAAATTCTGTGAAGTCTCAAGCTGTTCATTTTGTGCAGGTGTAAACATCACGT
GCACCTGATACTGTCGGCCATTTTAAAAATGATTGTAGGTAGAAGCATTTTATACCTGCA
GAATTGAATCCTAATTTTGACGTTGGTATACAACAAAGATTAGTAGCAGGCTTGTAGGTG
ATCTTTGTGCTGTACATGATGACAACTGGCTCCCTCTACTGAACTGCTATGAGGAAACTG
CCATGTCACCCTTCTGACTACAGCCACCTTTTGGGTTTCATTTAATTTTGGTAGTGTTAA
TGTCTATTAATGTGATTTTTTTTTTTAACCTTTCTCCCAATAGGTTGATGACAACAAGAA
ACTAGGAGAATGGGTAGGCCTTTGTAAAATTGACAGAGAGGGGAAACCCCGTAAAGTGGT
TGGTTGCAGTTGTGTAGTAGTTAAGGTAAGTCACCGTTTATTCTAGGGATGAAGGTTATG
CTGGGTAATCATATAAAACCTTGTATTGAAATAAGTTGAGGATCTTATAAAAGGAAAAAA
CTGATTCAACAGGTTTAAAGCATTTTCTGCATTTCAGGAAAAAAATAAAAGCTGTAATTT
GCAAGCCAGCCAATGAATCTGCTTACCTGATTGTGTTTGTGCAGACATACTTTAAAAACT
GGCAATAGTAAAGCCATGTTACGAGCCTTGAGGACATTGAAGTCGTTAAGGTCCCTGAGA
ATGGCTATAACAAATCTTAGTGATGGGAAACATTTTTATAAGACATAGCTAATTGTTGAA
GCTCCACTATAATTGATACTAATAGCTTGGTGAAATTCCTAAATATTAACAAGAAGTTGC
ATGCGTGTTTTGTTTTTTTTAAGGACTATGGCAAGGAGTCTCAGGCCAAGGATGTCATCG
AAGAGTATTTCAAATGCAAGAAATGAAGAAATAAATCTTTGGCTCACATTCCTCATGTCT
GGCTTTTTATTTGGGGCAGTAAAATAAGGTCCCCATTAGCAAAGTAAAATGTAATAATCG
CAAAGTGATTGCTACAGATTAACTGGAAACTTGCTCTCAAAGTCTTCTCCCCAGCCAATG
ACTGCATCATGGGGCAATTCAAACCTGGACAGCCTTAGCAAAGATAGGTCTGCCATGCAG
TGTTGGTGATGGCCAGGATTACTTAGCTATGGGCATTTATCCTTCACTAGACTAGCCTAG
AATCTGGAGAGAGAGGTTGTGTTTTTAATAGATTGCAGTCTATGAAAGGACAGTGAGTAG
ACTTGCTGGGCAGGTTAGTAGAAAGTACACAGTTGGGCCAGGGTCATATCTTGCATGTGG
GACAAGTGTATGATACCCAGGAATGCTTGTGGACATTCGTTTGACTTCTTTGGTTGGAGA
CGGAGTTTCACTCTTGTTGCCCAGGCTGGAGTGCAATGGCGCAATCTTGGCTCACTGCAA
CCTCTTTGTCCTGGGTTCGAGCGATTCTCGTGCCTCAACCTCCCAAGCAGCTAGGATTAC
AGATGCCTGGCAATTTTTTTGTGTTTTTAGTAGAGATGGGGTTTCACCATATTTGGCCAG
GATGGTCTAGAACTTAGCAGGTGATCCATCAGCTTCAGCCTTCCAAAGTGCTGGGATTAC
AAGTGTGAGCCACCATTCCTGGCCTTACTTTTGTGCAGGAGCGAGAGGGGCTTGAATGCA
CCCCAGTCCTTAGAAATCTCCGCAGTGAGAGAAGCCATGGCTGGTGTTTGGTGTATTTTA
AACTTGGATAAAGGTACCGTTAAAAGAATGTTGTGAGGCCATATACTTGGCCAATCCTGG
TTTTGAAGACTTTATACCAAGGTTTTTCTTTGCATCTTAAACCTTGAGAATCTCGGAGTA
GGGTCTCCCGTACTGGTTGGTTTGGTAGTTATAGCTAAAGCTGGTTGACCTTAGCATGGT
AGTGACATTGAGTACCCTCATGGAAAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1051, 1170..1220, 1409..1525, 2907..3009, 3403..3504, 3923..4006
1207..1220, 1409..1525, 2907..3009, 3403..3504, 3923..3982
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved